Skip to main content
. 2021 Jan 28;10:e63677. doi: 10.7554/eLife.63677

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Genetic reagent (Mus musculus) Transgenic
Myoc Y437H mice
Courtesy of Dr. Gulab Zode Zode et al., 2011 North Texas Eye Research Institute
Cell line (Homo sapiens) Trabecular Meshwork Stem Cells
(TMSCs)
This paper Cells isolated from both male and female donors, characterized, and maintained in Du lab
Cell line (Homo sapiens) Trabecular Meshwork Cells
(TM cells)
This paper
Cell line (Homo sapiens) Corneal fibroblasts This paper
Commercial assay or kit Mycoplasma contamination detection kit InvivoGen Cat# rep-pt1
Antibody Anti-Collagen IV
(Rabbit polyclonal)
Sigma-Aldrich Cat# SAB4500369 RRID:AB_10743858 IF(1:100)
WB(1:1000)
Antibody Anti-AQP1 (Mouse monoclonal) Santa Cruz Biotechnology Cat# sc25287 RRID:AB_626694 IF (1:100)
Antibody Anti-human CHI3L1 (Goat polyclonal) R and D Systems Cat# AF2599,
RRID:AB_2291883
IF(1:50), WB (1:250)
Antibody Anti-Ki67 (Rabbit polyclonal) Abcam Cat# ab15580 RRID:AB_443209 IF(1:500)
Antibody Anti-myocilin (Rabbit polyclonal) Santa Cruz Biotechnology Cat# Sc137233 RRID:AB_2148737 IF(1:100)
Antibody Anti-myocilin
(Mouse monoclonal)
R and D Systems Cat# MAB3446 RRID:AB_2148649 WB(1:500)
Antibody Anti-fibronectin (Rabbit polyclonal) Abcam Cat# b23750 RRID:AB_447655 WB(1:1000)
Antibody anti-elastin (Mouse monoclonal) Millipore Cat#: MAB2503 RRID:AB_2099602 WB(1:500)
Antibody CHOP
(Mouse monoclonal)
Cell Signaling Technology Cat#: 2895
RRID:AB_2089254
WB(1:500)
Antibody GRP78
(Mouse monoclonal)
Santa Cruz Biotechnology Cat# sc-376768 RRID:AB_2819145 WB(1:1000)
Antibody β-actin (Mouse monoclonal) Thermo Fisher Cat# MA5-15739 RRID:AB_10979409 WB(1:5000)
Recombinant DNA reagent pLentiCMV-GFP (plasmid) AddGene Cat# 17448 Lentiviral construct
Recombinant DNA reagent pCAGIG2 (plasmid) AddGene Cat# 111159 IRES-EGFP cassette
Recombinant DNA reagent pcDNA3 Myoc Y437H Courtesy of Dr. John Hulleman Zadoo et al., 2016 UT Southwestern
Sequence-based reagent Mouse DNA_F Thermo Fisher PCR primers GACTAAGGCAAGAAAATGAGAATC
Sequence-based reagent Mouse DNA _R Thermo Fisher PCR primers CCTCTCCACTCCTGAGATAGC
Sequence-based reagent Mutant Myoc_F Thermo Fisher PCR primers ACAAAGGCAGGGTCGAGAAGACAGG
Sequence-based reagent Mutant Myoc_R Thermo Fisher PCR primers TTCCCACCTCTCTCTCCCCATGAGA
Commercial assay or kit In Situ Cell Death Detection Kit Sigma-Aldrich Cat# 12156792910
Commercial assay or kit RNeasy Mini Kit Qiagen Cat# 74106
Commercial assay or kit cDNA Reverse Transcription Kit Life Technologies Cat# 4368813
Commercial assay or kit Power SYBR Green PCR Master Mix Life Technologies Cat# 4368708
Chemical compound opsonized Alexa 546-conjugated S. aureus bioparticles Thermo Fisher Cat# A10010
Software, algorithm String V11 https://string-db.org/ RRID:SCR_005223
Software, algorithm FlowJo version 10 https://www.flowjo.com/ RRID:SCR_008520
Software, algorithm ImageJ https://fiji.sc/ RRID:SCR_002285
Software, algorithm Graphpad Prism 8 https://www.graphpad.com/scientific-software/prism/ RRID:SCR_002798
Software, algorithm Espion version 6 http://diagnosysllc.com
Other DAPI Sigma-Aldrich Cat# D9542 Stain: 1 µg/ml