Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Transgenic Myoc Y437H mice |
Courtesy of Dr. Gulab Zode Zode et al., 2011 | North Texas Eye Research Institute | |
| Cell line (Homo sapiens) | Trabecular Meshwork Stem Cells (TMSCs) |
This paper | Cells isolated from both male and female donors, characterized, and maintained in Du lab | |
| Cell line (Homo sapiens) | Trabecular Meshwork Cells (TM cells) |
This paper | ||
| Cell line (Homo sapiens) | Corneal fibroblasts | This paper | ||
| Commercial assay or kit | Mycoplasma contamination detection kit | InvivoGen | Cat# rep-pt1 | |
| Antibody | Anti-Collagen IV (Rabbit polyclonal) |
Sigma-Aldrich | Cat# SAB4500369 RRID:AB_10743858 | IF(1:100) WB(1:1000) |
| Antibody | Anti-AQP1 (Mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc25287 RRID:AB_626694 | IF (1:100) |
| Antibody | Anti-human CHI3L1 (Goat polyclonal) | R and D Systems | Cat# AF2599, RRID:AB_2291883 |
IF(1:50), WB (1:250) |
| Antibody | Anti-Ki67 (Rabbit polyclonal) | Abcam | Cat# ab15580 RRID:AB_443209 | IF(1:500) |
| Antibody | Anti-myocilin (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat# Sc137233 RRID:AB_2148737 | IF(1:100) |
| Antibody | Anti-myocilin (Mouse monoclonal) |
R and D Systems | Cat# MAB3446 RRID:AB_2148649 | WB(1:500) |
| Antibody | Anti-fibronectin (Rabbit polyclonal) | Abcam | Cat# b23750 RRID:AB_447655 | WB(1:1000) |
| Antibody | anti-elastin (Mouse monoclonal) | Millipore | Cat#: MAB2503 RRID:AB_2099602 | WB(1:500) |
| Antibody | CHOP (Mouse monoclonal) |
Cell Signaling Technology | Cat#: 2895 RRID:AB_2089254 |
WB(1:500) |
| Antibody | GRP78 (Mouse monoclonal) |
Santa Cruz Biotechnology | Cat# sc-376768 RRID:AB_2819145 | WB(1:1000) |
| Antibody | β-actin (Mouse monoclonal) | Thermo Fisher | Cat# MA5-15739 RRID:AB_10979409 | WB(1:5000) |
| Recombinant DNA reagent | pLentiCMV-GFP (plasmid) | AddGene | Cat# 17448 | Lentiviral construct |
| Recombinant DNA reagent | pCAGIG2 (plasmid) | AddGene | Cat# 111159 | IRES-EGFP cassette |
| Recombinant DNA reagent | pcDNA3 Myoc Y437H | Courtesy of Dr. John Hulleman Zadoo et al., 2016 | UT Southwestern | |
| Sequence-based reagent | Mouse DNA_F | Thermo Fisher | PCR primers | GACTAAGGCAAGAAAATGAGAATC |
| Sequence-based reagent | Mouse DNA _R | Thermo Fisher | PCR primers | CCTCTCCACTCCTGAGATAGC |
| Sequence-based reagent | Mutant Myoc_F | Thermo Fisher | PCR primers | ACAAAGGCAGGGTCGAGAAGACAGG |
| Sequence-based reagent | Mutant Myoc_R | Thermo Fisher | PCR primers | TTCCCACCTCTCTCTCCCCATGAGA |
| Commercial assay or kit | In Situ Cell Death Detection Kit | Sigma-Aldrich | Cat# 12156792910 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Cat# 74106 | |
| Commercial assay or kit | cDNA Reverse Transcription Kit | Life Technologies | Cat# 4368813 | |
| Commercial assay or kit | Power SYBR Green PCR Master Mix | Life Technologies | Cat# 4368708 | |
| Chemical compound | opsonized Alexa 546-conjugated S. aureus bioparticles | Thermo Fisher | Cat# A10010 | |
| Software, algorithm | String V11 | https://string-db.org/ | RRID:SCR_005223 | |
| Software, algorithm | FlowJo version 10 | https://www.flowjo.com/ | RRID:SCR_008520 | |
| Software, algorithm | ImageJ | https://fiji.sc/ | RRID:SCR_002285 | |
| Software, algorithm | Graphpad Prism 8 | https://www.graphpad.com/scientific-software/prism/ | RRID:SCR_002798 | |
| Software, algorithm | Espion version 6 | http://diagnosysllc.com | ||
| Other | DAPI | Sigma-Aldrich | Cat# D9542 | Stain: 1 µg/ml |