Table 1.

List of primers used for pBK–CMV–K_Vβ1.3–IRES–K_V1.5–FLAG construction.

N-term
Forward	5′cggctgggctcagcgatgggcccaaggagccggc 3′
Reverse	5′ccccttgtcatcgtcgtccttgtagtccccgccagaggcgggggccatgaccccgctgccg 3′
C-term
Forward	5′ggggactacaaggacgacgatgacaaggggcctacggtggcaccgctcctgcccCGTACG 3′
Reverse	5′ gctcttccttaaggactgccggctcctcgtgatcc 3′

Underlined nucleotides indicate the recognition sequences of restriction endonucleases BlpI and AflII, respectively. Bold sequences indicate nucleotides corresponding to the FLAG sequence; glycines represented by italics were added to provide flexibility at the front and at the back of the insert; nucleotides in uppercase correspond with the insertion of a punctual and silent mutation, which result in a single BsiWI restriction site used as reporter of the insertion.