Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | B6.129P2-Pvalbtm1(cre)Arbr/J (PvalbCre) |
Jackson Laboratory | Stock #: 017320 RRID:MGI_3590684 |
|
| Genetic reagent (M. musculus) | C57BL/6J | Jackson Laboratory | Stock #: 000664 RRID:MGI_3028467 |
|
| Genetic reagent (M. musculus) | Inducible DLK overexpression: Hipp11-DLK(iOE) |
This paper | housed in UCSD vivarium | |
| Genetic reagent (M. musculus) | Inducible LZK overexpression: Hipp11-LZK(iOE) | This paper | housed in UCSD vivarium | |
| Genetic reagent (M. musculus) | Conditional DLK knockout (Map3k12fl) | Chen et al., 2016b | housed in UCSD vivarium | |
| Genetic reagent (M. musculus) | Conditional LZK knockout (Map3k13fl) | Chen et al., 2016b | housed in UCSD vivarium | |
| Genetic reagent (M. musculus) | Conditional Celf2 knockout (Celf2fl) | Chen et al., 2016a | housed in UCSD vivarium | |
| Genetic reagent (M. musculus) | CRISPR LZK knockout (Map3k13KO) | This paper | housed in UCSD vivarium | |
| Antibody | Anti-MAP3K12 (rabbit polyclonal) | Sigma-Aldrich | Cat. #: SAB2700169 RRID:AB_2714162 |
WB (1:2000), IF (1:250) |
| Antibody | Anti-MAP3K13 (rabbit polyclonal) |
Sigma-Aldrich | Cat. #: HPA016497 RRID:AB_10670027 | WB (1:300), IF (1:200), IP (2 μg per sample) |
| Antibody | Anti-Actin (Clone C4) (mouse monoclonal) | MP Biomedicals | Cat. #: 08691001 RRID:AB_2335127 |
WB (1:10,000) |
| Antibody | Anti-Bcl-xL (54H6) (rabbit monoclonal) | Cell signaling | Cat. #: 2764 RRID:AB_2228008 |
WB (1:2000) |
| Antibody | Anti-FLAG (rabbit polyclonal) | Millipore | Cat. #: F7425 RRID:AB_439687 |
WB (1:500) |
| Antibody | Sheep anti-mouse IgG (sheep polyclonal, HRP conjugated) | GE healthcare | Cat. #: NA931 RRID:AB_772210 |
WB (1:5000) |
| Antibody | Donkey anti-rabbit IgG (donkey polyclonal, HRP conjugated) | GE healthcare | Cat. #: NA934 RRID:AB_772206 |
WB (1:5000) |
| Antibody | Anti-Iba1 (rabbit polyclonal) | Wako | Cat. #: 019–19741 RRID:AB_839504 |
IF (1:1000) |
| Antibody | Anti-Neurofilament 200 (Phos. and Non-Phos.) (mouse monoclonal) | Sigma-Aldrich | Cat. #: N0142 RRID:AB_477257 |
IF (1:200) |
| Antibody | Anti-Phospho-c-Jun (Ser73) (D47G9) XP (rabbit monoclonal) | Cell signaling | Cat. #: 3270 RRID:AB_2129575 |
IF (1:200) |
| Antibody | Anti-Cleaved Caspase-3 (Asp175) (rabbit polyclonal) | Cell signaling | Cat. #: 9661 RRID:AB_2341188 |
IF (1:200) |
| Antibody | Anti-Calbindin (D1I4Q) XP (rabbit monoclonal) | Cell signaling | Cat. #: 13176 RRID:AB_2687400 |
IF (1:500) |
| Antibody | Anti-Calbindin D-28k (mouse monoclonal) | Swant | Cat. #: 300 RRID:AB_10000347 |
IF (1:500) |
| Antibody | Anti-GFAP (2.2B10) (rat monoclonal) | Thermo Fisher Scientific | Cat. #: 13–0300 RRID:AB_2532994 |
IF (1:500) |
| Antibody | Anti-MAP2 (chicken polyclonal) | Abcam | Cat. #: ab5392 RRID:AB_2138153 |
IF (1:500) |
| Antibody | Anti-Parvalbumin (guinea pig polyclonal) | Synaptic systems | Cat. #: 195004 RRID:AB_2156476 |
IF (1:500) |
| Antibody | Anti-tdTomato (goat polyclonal) | SICGEN | Cat. #: AB8181-200 RRID:AB_2722750 |
IF (1:500) |
| Antibody | Goat anti-mouse IgG (H+L) (goat polyclonal, Alexa Fluor 647 conjugated) | Invitrogen | Cat. #: A21236 RRID:AB_2535805 |
IF (1:500) |
| Antibody | Goat anti-guinea Pig IgG (H+L) (goat polyclonal, Alexa Fluor 488 conjugated) | Invitrogen | Cat. #: A11073 RRID:AB_2534117 |
IF (1:500) |
| Antibody | Goat anti-rabbit IgG (H+L) (goat polyclonal, Alexa Fluor 488 conjugated) |
Invitrogen | Cat. #: A11008 RRID:AB_143165 |
IF (1:500) |
| Antibody | Goat anti-rabbit IgG (H+L) (goat polyclonal, Alexa Fluor 647 conjugated) | Invitrogen | Cat. #: A21245 RRID:AB_2535813 |
IF (1:500) |
| Antibody | Goat anti-mouse IgG (H+L) (goat polyclonal, Alexa Fluor 488 conjugated) | Invitrogen | Cat. #: A11001 RRID:AB_2534069 |
IF (1:500) |
| Antibody | Goat anti-rat IgG (H+L) (goat polyclonal, Alexa Fluor 488 conjugated) | Invitrogen | Cat. #: A11006 RRID:AB_141373 |
IF (1:500) |
| Antibody | Goat anti-chicken IgG (H+L) (goat polyclonal, Alexa Fluor 647 conjugated) | Invitrogen | Cat. #: A21449 RRID:AB_1500594 |
IF (1:500) |
| Recombinant DNA reagent | pBT378-LSL-3X Flag-DLK-T2A-tdTomato (plasmid) | This paper | Construct Hipp11-DLK(iOE) mice | |
| Recombinant DNA reagent | pBT378-LSL-1X Flag-LZK-T2A-tdTomato (plasmid) | This paper | Construct Hipp11-LZK(iOE) mice | |
| Sequence-based reagent | sgRNA2-Fw | This paper | CACCGTGGCACTACAGGTCACATAC | |
| Sequence-based reagent | sgRNA2-Re | This paper | AAACGTATGTGACCTGTAGTGCCAC | |
| Sequence-based reagent | sgRNA5-Fw | This paper | CACCGGACCTCGTACAGCTGTCCGT | |
| Sequence-based reagent | sgRNA5-Re | This paper | AAACACGGACAGCTGTACGAGGTCC | |
| Sequence-based reagent | sgRNA12-Fw | This paper | CACCGACTCCAGTATAGCCTCGATG | |
| Sequence-based reagent | sgRNA12-Re | This paper | AAACCATCGAGGCTATACTGGAGTC | |
| Commercial assay or kit | SuperScript IV First-Strand Synthesis System | Invitrogen | 18091050 | |
| Commercial assay or kit | iQ SYBR Supermix | Bio-Rad | 170–8882 | |
| Commercial assay or kit | Surveyor Mutation Detection Kit | IDT | 706020 | |
| Commercial assay or kit | MEGAscript T7 Transcription Kit | Invitrogen | AMB13345 | |
| Commercial assay or kit | MEGAclear-96 Transcription Clean-Up Kit | Invitrogen | AM1909 | |
| Commercial assay or kit | H and E staining Kit | Abcam | ab245880 | |
| Commercial assay or kit | Pierce BCA protein assay kit | Thermo Fisher Scientific | 23225 | |
| Commercial assay or kit | DeadEnd Fluorometric TUNEL System | Promega | G3250 | |
| Software, algorithm | ImageJ software | ImageJ (https://imagej.net/) |
RRID:SCR_003070 | |
| Software, algorithm | GraphPad Prism software |
GraphPad Prism (http://www.graphpad.com/) |
RRID:SCR_002798 | Version 6.0 |
| Software, algorithm | CFX Manager | CFX Manager (http://www.bio-rad.com/en-eh/product/cfx-manager-software) | RRID:SCR_017251 | |
| Software, algorithm | NDP.view2 Viewing software | Hamamatsu Photonics (https://www.hamamatsu.com/us/en/product/type/U12388-01/index.html) | RRID:SCR_017105 | |
| Other | DAPI stain | Invitrogen | D1306 | (14.3 μM) |