Skip to main content
. 2021 Jan 21;10:e63509. doi: 10.7554/eLife.63509

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional information
Genetic reagent (M. musculus) B6.129P2-Pvalbtm1(cre)Arbr/J
(PvalbCre)
Jackson Laboratory Stock #: 017320
RRID:MGI_3590684
Genetic reagent (M. musculus) C57BL/6J Jackson Laboratory Stock #: 000664
RRID:MGI_3028467
Genetic reagent (M. musculus) Inducible DLK overexpression:
Hipp11-DLK(iOE)
This paper housed in UCSD vivarium
Genetic reagent (M. musculus) Inducible LZK overexpression: Hipp11-LZK(iOE) This paper housed in UCSD vivarium
Genetic reagent (M. musculus) Conditional DLK knockout (Map3k12fl) Chen et al., 2016b housed in UCSD vivarium
Genetic reagent (M. musculus) Conditional LZK knockout (Map3k13fl) Chen et al., 2016b housed in UCSD vivarium
Genetic reagent (M. musculus) Conditional Celf2 knockout (Celf2fl) Chen et al., 2016a housed in UCSD vivarium
Genetic reagent (M. musculus) CRISPR LZK knockout (Map3k13KO) This paper housed in UCSD vivarium
Antibody Anti-MAP3K12 (rabbit polyclonal) Sigma-Aldrich Cat. #: SAB2700169
RRID:AB_2714162
WB (1:2000),
IF (1:250)
Antibody Anti-MAP3K13
(rabbit polyclonal)
Sigma-Aldrich Cat. #: HPA016497 RRID:AB_10670027 WB (1:300),
IF (1:200),
IP (2 μg per sample)
Antibody Anti-Actin (Clone C4) (mouse monoclonal) MP Biomedicals Cat. #: 08691001
RRID:AB_2335127
WB (1:10,000)
Antibody Anti-Bcl-xL (54H6) (rabbit monoclonal) Cell signaling Cat. #: 2764
RRID:AB_2228008
WB (1:2000)
Antibody Anti-FLAG (rabbit polyclonal) Millipore Cat. #: F7425
RRID:AB_439687
WB (1:500)
Antibody Sheep anti-mouse IgG (sheep polyclonal, HRP conjugated) GE healthcare Cat. #: NA931
RRID:AB_772210
WB (1:5000)
Antibody Donkey anti-rabbit IgG (donkey polyclonal, HRP conjugated) GE healthcare Cat. #: NA934
RRID:AB_772206
WB (1:5000)
Antibody Anti-Iba1 (rabbit polyclonal) Wako Cat. #: 019–19741
RRID:AB_839504
IF (1:1000)
Antibody Anti-Neurofilament 200 (Phos. and Non-Phos.) (mouse monoclonal) Sigma-Aldrich Cat. #: N0142
RRID:AB_477257
IF (1:200)
Antibody Anti-Phospho-c-Jun (Ser73) (D47G9) XP (rabbit monoclonal) Cell signaling Cat. #: 3270
RRID:AB_2129575
IF (1:200)
Antibody Anti-Cleaved Caspase-3 (Asp175) (rabbit polyclonal) Cell signaling Cat. #: 9661
RRID:AB_2341188
IF (1:200)
Antibody Anti-Calbindin (D1I4Q) XP (rabbit monoclonal) Cell signaling Cat. #: 13176
RRID:AB_2687400
IF (1:500)
Antibody Anti-Calbindin D-28k (mouse monoclonal) Swant Cat. #: 300
RRID:AB_10000347
IF (1:500)
Antibody Anti-GFAP (2.2B10) (rat monoclonal) Thermo Fisher Scientific Cat. #: 13–0300
RRID:AB_2532994
IF (1:500)
Antibody Anti-MAP2 (chicken polyclonal) Abcam Cat. #: ab5392
RRID:AB_2138153
IF (1:500)
Antibody Anti-Parvalbumin (guinea pig polyclonal) Synaptic systems Cat. #: 195004
RRID:AB_2156476
IF (1:500)
Antibody Anti-tdTomato (goat polyclonal) SICGEN Cat. #: AB8181-200
RRID:AB_2722750
IF (1:500)
Antibody Goat anti-mouse IgG (H+L) (goat polyclonal, Alexa Fluor 647 conjugated) Invitrogen Cat. #: A21236
RRID:AB_2535805
IF (1:500)
Antibody Goat anti-guinea Pig IgG (H+L) (goat polyclonal, Alexa Fluor 488 conjugated) Invitrogen Cat. #: A11073
RRID:AB_2534117
IF (1:500)
Antibody Goat anti-rabbit IgG (H+L)
(goat polyclonal, Alexa Fluor 488 conjugated)
Invitrogen Cat. #: A11008
RRID:AB_143165
IF (1:500)
Antibody Goat anti-rabbit IgG (H+L) (goat polyclonal, Alexa Fluor 647 conjugated) Invitrogen Cat. #: A21245
RRID:AB_2535813
IF (1:500)
Antibody Goat anti-mouse IgG (H+L) (goat polyclonal, Alexa Fluor 488 conjugated) Invitrogen Cat. #: A11001
RRID:AB_2534069
IF (1:500)
Antibody Goat anti-rat IgG (H+L) (goat polyclonal, Alexa Fluor 488 conjugated) Invitrogen Cat. #: A11006
RRID:AB_141373
IF (1:500)
Antibody Goat anti-chicken IgG (H+L) (goat polyclonal, Alexa Fluor 647 conjugated) Invitrogen Cat. #: A21449
RRID:AB_1500594
IF (1:500)
Recombinant DNA reagent pBT378-LSL-3X Flag-DLK-T2A-tdTomato (plasmid) This paper Construct Hipp11-DLK(iOE) mice
Recombinant DNA reagent pBT378-LSL-1X Flag-LZK-T2A-tdTomato (plasmid) This paper Construct Hipp11-LZK(iOE) mice
Sequence-based reagent sgRNA2-Fw This paper CACCGTGGCACTACAGGTCACATAC
Sequence-based reagent sgRNA2-Re This paper AAACGTATGTGACCTGTAGTGCCAC
Sequence-based reagent sgRNA5-Fw This paper CACCGGACCTCGTACAGCTGTCCGT
Sequence-based reagent sgRNA5-Re This paper AAACACGGACAGCTGTACGAGGTCC
Sequence-based reagent sgRNA12-Fw This paper CACCGACTCCAGTATAGCCTCGATG
Sequence-based reagent sgRNA12-Re This paper AAACCATCGAGGCTATACTGGAGTC
Commercial assay or kit SuperScript IV First-Strand Synthesis System Invitrogen 18091050
Commercial assay or kit iQ SYBR Supermix Bio-Rad 170–8882
Commercial assay or kit Surveyor Mutation Detection Kit IDT 706020
Commercial assay or kit MEGAscript T7 Transcription Kit Invitrogen AMB13345
Commercial assay or kit MEGAclear-96 Transcription Clean-Up Kit Invitrogen AM1909
Commercial assay or kit H and E staining Kit Abcam ab245880
Commercial assay or kit Pierce BCA protein assay kit Thermo Fisher Scientific 23225
Commercial assay or kit DeadEnd Fluorometric TUNEL System Promega G3250
Software, algorithm ImageJ software ImageJ
(https://imagej.net/)
RRID:SCR_003070
Software, algorithm GraphPad
Prism software
GraphPad Prism
(http://www.graphpad.com/)
RRID:SCR_002798 Version 6.0
Software, algorithm CFX Manager CFX Manager (http://www.bio-rad.com/en-eh/product/cfx-manager-software) RRID:SCR_017251
Software, algorithm NDP.view2 Viewing software Hamamatsu Photonics (https://www.hamamatsu.com/us/en/product/type/U12388-01/index.html) RRID:SCR_017105
Other DAPI stain Invitrogen D1306 (14.3 μM)