Skip to main content
. Author manuscript; available in PMC: 2021 Feb 9.
Published in final edited form as: Gene. 2019 Mar 4;699:110–114. doi: 10.1016/j.gene.2019.02.059

Fig. 1.

Fig. 1.

Sanger sequencing chromatograms for DNA from the proband and her parents. The trio analysis indicates occurrence of the SKIV2L variants in trans in the proband.

Primers used for targeted amplification and sequencing of the gene regions containing the SKIV2L variants are as follows: Forward TGGGTCTGAGGGGAAGAAAG and reverse GATCTGACCTCTGGCCAATAG (exon 9) for NM_006929.4:c.904C>T, and forward GTTGCTTCCTGATTCCTGCCC and reverse CACTACAACCCCACCACTTC (exon 22) for NM_006929.4:c.2662_2663delAG.