REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
COV2-2050	Zost et al., 2020b	N/A
COV2-2050 LALA-PG	This paper	N/A
COV2-2072	Zost et al., 2020b	N/A
COV2-2072 LALA-PG	This paper	N/A
COV2-3025	Zost et al., 2020b	N/A
COV2-3025 LALA-PG	This paper	N/A
COV2-2381	Zost et al., 2020b	N/A
COV2-2381 LALA-PG	This paper	N/A
COV2-2072 mIgG1	This paper	N/A
COV2-2072 mIgG1 D265A	This paper	N/A
COV2-2072 mIgG2a	This paper	N/A
DENV-2D22	Fibriansah et al., 2015	N/A
HRP conjugated goat anti-mouse IgG (H + L)	Jackson ImmunoResearch	115-035-062; RRID: AB_2338504
CR3022, anti-SARS-CoV-2 mAb	Yuan et al., 2020	N/A
Goat anti-human lambda, mouse ads-UNLB	Southern Biotech	RRID:AB_2795760
Goat anti-human kappa, mouse ads-UNLB	Southern Biotech	RRID:AB_2795728
Goat anti-human IgG Fc, Multispecies ads-HRP	Southern Biotech	RRID:AB_2795580
BUV395 anti-CD45	BD BioSciences	RRID:AB_2651134
Brilliant Violet 650 anti-mouse Ly-6G	BioLegend	RRID:AB_2565881
Pacific Blue anti-mouse Ly-6C	BioLegend	RRID:AB_1732090
PE/Dazzle 594 anti-mouse/human CD11b	BioLegend	RRID:AB_2563648
Brilliant Violet 711 anti-mouse CD3 Antibody	BioLegend	RRID:AB_2563945
Brilliant Violet 421 anti-mouse CD3 Antibody	BioLegend	RRID:AB_10900227
APC anti-mouse CD8b Antibody	BioLegend	RRID:AB_2562774
PE anti-mouse/rat XCR1 Antibody	BioLegend	RRID:AB_2563843
Brilliant Violet 785 anti-mouse CD4 Antibody	BioLegend	RRID:AB_2565843
BV421 Rat Anti-Mouse CD335	BD BioSciences	RRID:AB_2737837
FITC anti-mouse NK-1.1 Antibody	BioLegend	RRID:AB_313393
PE-Cy7 Hamster Anti-Mouse CD11c	BD BioSciences	RRID:AB_2033997
Alexa Fluor® 700 anti-mouse I-A/I-E	BioLegend	RRID:AB_493726
eBioscience Fixable Viability Dye eFluor 506	Thermo Fisher	65-0866-14
FITC Anti-Neutrophil (Anti-Ly6B) Antibody	Abcam	RRID:AB_881408
TruStain FcX (anti-mouse CD16/32) Antibody	BioLegend	RRID:AB_1574973
Brilliant Violet 711 anti-mouse/human CD45R/B220 Antibody	BioLegend	RRID:AB_2563491
Brilliant Violet 711 anti-mouse/human CD11b Antibody	BioLegend	RRID:AB_2563310
FITC anti-mouse CD24 Antibody	BioLegend	RRID:AB_312839
PerCP/Cyanine5.5 anti-mouse Ly-6G Antibody	BioLegend	RRID:AB_1877271
PE/Cyanine7 anti-mouse CD64 (FcγRI) Antibody	BioLegend	RRID:AB_2563904
PE Rat Anti-Mouse Siglec-F	BD BioSciences	RRID:AB_394341
Brilliant Violet 605 anti-mouse CD80 Antibody	BioLegend	RRID:AB_11126141
PE/Cyanine5 anti-mouse CD86 Antibody	BioLegend	RRID:AB_493602
Brilliant Violet 605 anti-mouse CD62L Antibody	BioLegend	RRID:AB_2563058
APC/Cyanine7 anti-mouse/human CD44 Antibod6	BioLegend	RRID:AB_830785
PE/Cyanine7 anti-mouse TNF-α Antibody	BioLegend	RRID:AB_2256076
Brilliant Violet 421 anti-mouse CD64 (FcγRI) Antibody	BioLegend	RRID:AB_2562694
APC-Cy7 Hamster Anti-Mouse CD11c	BD BioSciences	RRID:AB_10611727
NOS Monoclonal Antibody (CXNFT), APC, eBioscience	Thermo Fisher	RRID:AB_2573244
InVivoMAb rat IgG2b isotype control, anti-keyhole limpet hemocyanin	BioXCell	RRID:AB_1107780
InVivoMAb anti-mouse Ly6G	BioXCell	RRID:AB_1107721
InVivoMAb rat IgG2a isotype control, anti-trinitrophenol	BioXCell	RRID:AB_1107769
InVivoPlus anti-mouse CD8α	BioXCell	RRID:AB_10950145
InVivoMAb anti-mouse NK1.1	BioXCell	RRID:AB_1107737
InVivoMAb mouse IgG2a isotype control, unknown specificity	BioXCell	RRID:AB_1107771
anti-CCR2 (clone MC-21)	Matthias Mack	N/A
Chemicals, peptides, and recombinant proteins
Recombinant Mouse Fc gamma RIIB/CD32b Protein, CF	R and D Systems	1460-CD-050
Recombinant Mouse Fc gamma RI/CD64 Protein, CF	R and D Systems	2074-FC-050
Recombinant Mouse FcgR4/CD16-2 Protein, CF	R and D Systems	1974-CD-050
Critical commercial assays
GIBCO ExpiCHO Expression System	ThermoFisher Scientific	A29133
MagMAX-96 Viral RNA Isolation Kit	Thermo Fisher	AM1836
MagMAX mirVana Total RNA Isolation Kit	Thermo Fisher	A27828
TaqMan RNA-to-Ct 1-Step Kit	Thermo Fisher	4392939
Mouse Cytokine Array / Chemokine Array 44-Plex (MD44)	Eve Technologies	MD44
Mouse Cytokine Array / Chemokine Array 31-Plex (MD31)	Eve Technologies	MD31
Ambion DNase I (RNase-free)	Thermo Fisher	AM2222
High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor	Thermo Fisher	4374966
Foxp3/Transcription Factor Staining Buffer Set	Thermo Fisher	00-5523-00
Endotoxin PTS201F cartridge	Charles River	PTS201F
SeqPlex RNA Amplification Kit	Millipore Sigma	EQR-500RXN
Virus and bacterial strains
SARS-CoV-2 (strain 2019 n-CoV/USA_WA1/2020)	CDC/BEI Resources	NR52281
Experimental models: Cell lines
Vero CCL-81	ATCC	CCL-81; RRID: CVCL_0059
Vero E6	ATCC	CRL-1586; RRID:CVCL_0574
Hamster: ExpiCHO-S	ThermoFisher Scientific	Cat#A29127; RRID: CVCL_5J31
Vero Furin	Mukherjee et al., 2016	N/A
Experimental models: Organisms/strains
Mouse: B6.Cg-Tg(K18-ACE2)2Prlmn/J	Jackson Laboratory	Cat# 034860; RRID:IMSR_JAX:03486
Golden Syrian Hamster	Charles River Laboratory	Strain Code: 049
Oligonucleotides
SARS-CoV-2 N F: 5′-ATGCTGCAATCGTGCTACAA-3′	32838945	N/A
SARS-CoV-2 N R: 5′-GACTGCCGCCTCTGCTC-3′	32838945	N/A
SARS-CoV-2 N Probe: 5′-/56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/-3′	32838945	N/A
SARS-CoV-2 RNA ISH probe (S gene)	Advanced Cell Diagnostics	Cat# 4848561
Hamster Rpl18 TaqMan F: GTTTATGAGTCGCACTAACCG	This paper	N/A
Hamster Rpl18 TaqMan R: TGTTCTCTCGGCCAGGAA	This paper	N/A
Hamster Rpl18 TaqMan Probe: YAK-TCTGTCCCTGTCCCGGATGATC-BBQ	This paper	N/A
Hamster Cxcl10 TaqMan F: GCCATTCATCCACAGTTGACA	This paper	N/A
Hamster Cxcl10 TaqMan R: CATGGTGCTGACAGTGGAGTCT	This paper	N/A
Hamster Cxcl10 TaqMan Probe: 6FAM-CGTCCCGAGCCAGCCAACGA-BBQ	This paper	N/A
Hamster Ccl2 TaqMan F: CTCACCTGCTGCTACTCATTC	This paper	N/A
Hamster Ccl2 TaqMan R: CTCTCTCTTGAGCTTGGTGATG	This paper	N/A
Hamster Ccl2 TaqMan Probe: 6FAM- CAGCAGCAAGTGTCCCAAAGAAGC-BBQ	This paper	N/A
Hamster Ccl3 TaqMan F: CTCACCTGCTGCTACTCATTC	This paper	N/A
Hamster Ccl3 TaqMan R: CTCTCTCTTGAGCTTGGTGATG	This paper	N/A
Hamster Ccl3 TaqMan Probe: 6FAM- CAGCAGCAAGTGTCCCAAAGAAGC-BBQ	This paper	N/A
Hamster Ccl5 TaqMan F: TGCTTTGACTACCTCTCCTTTAC	This paper	N/A
Hamster Ccl5 TaqMan R: GGTTCCTTCGGGTGACAAA	This paper	N/A
Hamster Ccl5 TaqMan Probe: 6FAM- TGCCTCGTGTTCACATCAAGGAGT-BBQ	This paper	N/A
Hamster Ifit3 TaqMan F: CTGATACCAACTGAGACTCCTG	This paper	N/A
Hamster Ifit3 TaqMan R: CTTCTGTCCTTCCTCGGATTAG	This paper	N/A
Hamster Ifit3 TaqMan Probe: 6FAM- ACCGTACAGTCCACACCCAACTTT-BBQ	This paper	N/A
Software and algorithms
FlowJo	FlowJo, LLC	v10
GraphPad Prism	GraphPad	v 9.0.0
Biorender	biorender.com	N/A
flexiWare	SCIREQ Inc.	v8.1.3
STAR program	Dobin et al., 2013	v 2.5.1a
EdgeR	Robinson et al., 2010	N/A
limma	Ritchie et al., 2015	N/A
RSeQC	Liao et al., 2014	v2.6.2
Nanozoomer Digital Pathology	Hamamatsu	v2
Recombinant DNA
Plasmid: rCOV2-2050 in pTwist-mCis_hG1	Zost et al., 2020b	N/A
Plasmid: rCOV2-2050 in pTwist-mCis_hG1 LALA-PG	This study	N/A
Plasmid: rCOV2-2381 in pTwist-mCis_hG1	Zost et al., 2020b	N/A
Plasmid: rCOV2-2381 in pTwist-mCis_hG1 LALA-PG	This study	N/A
Plasmid: rCOV2-2072 in pTwist-mCis_hG1	Zost et al., 2020b	N/A
Plasmid: rCOV2-2072 in pTwist-mCis_hG1 LALA-PG	This study	N/A
Plasmid: rCOV2-3025 in pTwist-mCis_hG1	Zost et al., 2020b	N/A
Plasmid: rCOV2-3025 in pTwist-mCis_hG1 LALA-PG	This study	N/A
Plasmid: rCOV2-2072 in pTwist-mCis_mG1	This study	N/A
Plasmid: rCOV2-2072 in pTwist-mCis_mG1 D265A	This study	N/A
Plasmid: rCOV2-2072 in pTwist-mCis_mG2a	This study	N/A
Plasmid: rCOV2-2072 in pTwist-mCis_mK	This study	N/A
Deposited data
Lung RNA-Seq Data	This paper	GEO: GSE161615
Other
HiTrap MabSelect SuRe	Cytvia	11003493
CountBright Absolute Counting Beads	Thermo Fisher	C36950