Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Protospacer sequences selected for the gene editing of A. aculeatus TBRC 277
| Spacer ID | Gene target | Genomic target sequence (5′> 3′) | PAM | Promoter | Location (ATG Start) |
|---|---|---|---|---|---|
| pyrG-1 | pyrG | GCCAGCGGGTTGGTGTGCTT | TTTN | U3-AF | 43–62 |
| pyrG-2 | pyrG | GGCGGGGCCCTACGGTCAGC | TTTN | U3-AF | 151–170 |
| pyrG-3 | pyrG | TCATGGGGTTCGTGTCGACG | TTTN | U3-AF | 632–650 |
