Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Apr 1.
Published in final edited form as: J Invest Dermatol. 2020 Aug 13;141(4 Suppl):1007–1016. doi: 10.1016/j.jid.2020.07.019

Dermal Fibroblast CCN1 Expression in Mice Recapitulates Human Skin Dermal Aging

Taihao Quan 1, Yaping Xiang 1, Yingchun Liu 1, Zhaoping Qin 1, Yan Yang 1, George Bou-Gharios 2, John J Voorhees 1, Andrzej A Dlugosz 1, Gary J Fisher 1
PMCID: PMC7881053  NIHMSID: NIHMS1621326  PMID: 32800875

Abstract

The aging process deleteriously alters the structure and function of dermal collagen. These alterations result in thinning, fragility, wrinkles, laxity, impaired wound healing, and a microenvironment conducive to cancer. However, the key factors responsible for these changes have not been fully elucidated, and relevant models for the study of skin aging progression are lacking. CCN1, a secreted extracellular matrix‒associated matricellular protein, is elevated in dermal fibroblasts in aged human skin. Toward constructing a mouse model to study the key factors involved in skin-aging progression, we demonstrate that transgenic mice, with selective expression of CCN1 in dermal fibroblasts (COL1A2-CCN1), display accelerated skin dermal aging. The aged phenotype in COL1A2-CCN1 mice resembles aged human dermis: the skin is wrinkled and the dermis is thin and composed of loose, disorganized, and fragmented collagen fibrils. These dermal alterations reflect reduced production of collagen due to impaired TGFβ signaling and increased expression of matrix metalloproteinases driving the induction of c-Jun/activator protein-1. Importantly, similar mechanisms drive human dermal aging. Taken together, the data demonstrate that elevated expression of CCN1 by dermal fibroblasts functions as a key mediator of dermal aging. The COL1A2-CCN1 mouse model provides a novel tool for understanding and studying the mechanisms of skin aging and age-related skin disorders.

INTRODUCTION

As the average expected lifespan increases, the consequences of aging are becoming an increasingly prominent public health issue. Aging affects all individuals and is the highest risk factor for most human diseases (Kennedy et al., 2014), including skin diseases (Beauregard and Gilchrest, 1987). Histological and ultrastructural studies of aged skin have revealed prominent alterations in the collagen-rich dermal extracellular matrix (ECM), which comprises the bulk of skin (Jacob, 2003; Yaar and Gilchrest, 2001). These deleterious alterations include loss of dermal mass owing to reduced production (Quan et al., 2010b) and increased fragmentation (Fisher et al., 2009) of dermal collagen fibrils.

Collagen fibrils are responsible for the structural and mechanical support provided by the dermis. Collagen fibrils also serve as a substrate for cellular attachment, which critically regulates cell function (Plant et al., 2009; Sweeney et al., 2008). In addition, the dermal ECM serves as a repository for a variety of bioactive proteins. Therefore, age-related degeneration of dermal collagen fibrils broadly impacts skin function (Smith et al., 1962). Age-related alterations of collagen fibrils also create a tissue microenvironment that is directly related to age-related skin pathologies, such as increased fragility (Ma et al., 2001), impaired vasculature support (Jacob, 2003), poor wound healing (Eaglstein, 1989), and promotion of skin cancer (Rogers et al., 2015).

We previously reported that the matricellular protein CCN1 is markedly elevated in aged human skin (Quan et al., 2006). CCN1 is the first member of the CCN protein family, which comprises six members, CCN1‒CCN6 (Ayer-Lelievre et al., 2001). Members of the CCN family exhibit diverse cellular functions, including the regulation of cell proliferation, chemotaxis, apoptosis, adhesion, motility, and ion transport and ECM regulation (Jun and Lau, 2011). CCN1 has been reported to regulate cell adhesion, migration, chemotaxis, inflammation, cell-matrix interactions, synthesis of ECM proteins, and wound healing (Lau, 2011). CCN1 functions by interacting with multiple integrins in a cell-type and context-dependent manner.

We have previously reported that CCN1 regulates collagen homeostasis through αVβ3 integrin in human skin fibroblasts (Qin et al., 2013). It has been reported that heparin sulfate proteoglycans bind to CCN1 and may serve as coreceptors (Chen et al., 2000). CCN1 interaction with integrin and/or heparin sulfate proteoglycans induces a diverse range of cellular responses including increasing intracellular levels of ROS (Chen et al., 2007). Chen et al., (2007) demonstrated that exogenously added CCN1 raises ROS levels through ROS generation and release from mitochondria, a phenomenon that is known to contribute to an oxidative stress response. In adult human dermal fibroblasts, ROS negatively regulates collagen production (He et al., 2014), whereas in fibrogenic myofibroblasts, ROS is involved in the stimulation of collagen production (Dosoki et al., 2017; Wermuth et al., 2019). Thus, it appears that the role of ROS in the regulation of collagen production by ROS is complex and dependent on multiple factors, including cell type, the presence of proinflammatory mediators, and tissue milieu. The knockout of CCN1 in mice is embryonically lethal. This lethality is primarily because of the impairment of ECM homeostasis, which leads to failure of vascular development (Mo et al., 2002).

CCN1 is expressed predominantly in dermal fibroblasts in human skin (Quan et al., 2006), the major cells responsible for collagen homeostasis. Elevated expression of CCN1 in cultured primary adult human dermal fibroblasts causes alterations in the expression of ECM genes similar to those observed in the dermis of aged human skin (Quan et al., 2006).

To explore the role of CCN1 in skin aging, we created a transgenic mouse model that selectively expresses CCN1 in dermal fibroblasts using the COL1A2 enhancer and promoter sequences. COL1A2-CCN1 mice exhibit accelerated aging of the dermis, characterized by loss of and fragmentation of collagen fibrils, which closely resembles aged human skin. Mechanistic investigations revealed that CCN1-associated impairment of TGFβ signaling, the major regulator of collagen and other ECM components, contributes to dermal thinning through reduced production of collagen. Furthermore, the upregulation of the transcription factor c-Jun/activator protein 1 (AP-1) contributes to collagen fibril fragmentation, through elevated expression of multiple matrix metalloproteinases (MMPs), in COL1A2-CCN1 mice. Thus, fibroblast-derived CCN1 expression orchestrates key age-related changes in dermal ECM by dysregulating both the production and homeostasis of collagen.

RESULTS AND DISCUSSION

Fibroblast expression of CCN1 induces age-related alterations in the dermal ECM

COL1A2-CCN1 mice were generated using a DNA construct containing the protein-coding sequences of human CCN1 under the control of the regulatory sequences of the human COL1A2 proximal gene promoter and upstream enhancer (Figure 1a), which is selectively expressed in fibroblasts (Bou-Gharios et al., 1996; Sonnylal et al., 2010). PCR-based genotyping identified nine COL1A2-CCN1 transgenic founders, and extensive CCN1 transgene expression was observed throughout the dermis as shown by immunohistology (Supplementary Figure S1a), quantitative RT-PCR (Supplementary Figure S1b), and western blot (Supplementary Figure S1c). Three lines with similar CCN1 transgene expression in the skin (Supplementary Figure S1c) were used for the studies presented in this report.

Figure 1. Transgene expression of CCN1 in dermal fibroblasts causes age-related alterations of the dermal-aged phenotype in mouse skin dermis.

Figure 1.

Open in a new tab

(a) Schematic representation of the construct expressed in dermal fibroblasts. (b) Representative gross appearance of 6-month-old COL1A2-CCN1 mouse (right) and their CTRLs (left). (c) Bodyweight of COL1A2-CCN1 mice and their CTRLs was measured at 6 months after birth (n = 6 mice per genotype). (d) Accumulation of CCN1 protein expression in COL1A2-CCN1 mice and their CTRLs over 6 months. Inset shows representative western blots. CCN1 protein relative levels were determined by quantification of band intensity after normalization to the internal control β-actin band intensity. (e) H&E staining in samples taken from CTRL and COL1A2-CCN1 mice, with representative images shown. The dermal thickness was quantified by computerized image analysis (Image-pro Plus software, version 4.1, Media Cybernetics, Rockville, MD). Bar = 100 μm. (f) Masson’s trichrome staining showing representative images. The dermal collagenous ECM is stained blue, cells are stained red, and the nuclei are stained black. Subcutaneous fat appears white. Collagen fibril staining (blue) per microscopic field was quantified by ImageJ software. Bar = 100 μm. (g) AFM of collagen fibrils. Bar = 200 nm. Representative images are shown. The blue arrowheads indicate intact collagen fibrils, and the red arrowheads indicate damaged collagen fibrils. (h) Dermal collagen fibril organization, measured as Collagen fibril Ra (nm), was quantified using Nanoscope Analysis software (Nanoscope_Analysis_v120R1sr3, Bruker-AXS, Santa Barbara, CA). All results are expressed as mean ± SEM, n = 3 mice per genotype, *P < 0.05. AFM, atomic force microscopy; CTRL, nontransgenic littermate control; ECM, extracellular matrix; IRES, internal ribosome entry site; Ra, average roughness.

Newborn COL1A2-CCN1 mice were grossly normal in appearance, and histological evaluation revealed normal skin morphology (Supplementary Figure S1a). However, by 6 months of age, all the three lines of COL1A2-CCN1 mice exhibited an aged appearance, characterized by reduced size (Figure 1b), reduced weight (Figure 1c) (20% less weight than control littermates), and wrinkles on their dorsal skin (Supplementary Figure S2a). The development of the aged appearance began at approximately 2 months of age and gradually became more apparent during the following 4 months. The degree of the aged appearance paralleled the accumulation and/or increases of CCN1 protein in the skin (Figure 1d).

Histological examination revealed dermal thinning in COL1A2-CCN1 mice by 6 months of age. Dermal thickness was reduced by 46% compared with that of nontransgenic sex- and age-matched littermates (Figure 1e). Masson’s trichrome (Figure 1f) and Sirius red (Supplementary Figure S2b) staining, which visualize collagen fibrils, revealed a reduced density of collagen fibrils in COL1A2-CCN1 mice. Nanoscale analysis by atomic force microscopy (AFM) indicated that collagen fibrils were significantly fragmented and disorganized in COL1A2-CCN1 transgenic mice (Figure 1g). Collagen fibrils displayed an amorphous appearance, with loss of distinct longitudinal fibrillar structure and perpendicular striated pattern (referred to as D-spacing), which are characteristic topographic features of intact collagen fibrils. These structural alterations of collagen fibrils resemble those overserved in aged human skin (Qin et al., 2014; Quan et al., 2009). Quantitative analysis demonstrated that the average roughness of collagen fibrils, an indicator of collagen fibril organization, was 2.6-fold greater in COL1A2-CCN1 mice than in nontransgenic littermates (25 nm vs. 66 nm) (Figure 1h).

Importantly, the dermal features observed in COL1A2-CCN1 mice closely resemble alterations that are observed in the dermis of aged human skin, such as aberrant collagen homeostasis (Qin et al., 2014, 2013; Quan et al., 2006). This finding supports the concept that elevated dermal expression of CCN1 is a critical driver of age-related dermal alterations.

Impaired TGFβ signaling reduces type I collagen and leads to dermal thinning in COL1A2-CCN1 mice

To examine possible molecular pathways that promote dermal thinning, we cultured dermal fibroblasts from COL1A2-CCN1 mice and control littermates. We found that fibroblasts from COL1A2-CCN1 mice express significantly less type I collagen (COL-1) mRNA (Figure 2a) and protein (Figure 2b). These data are consistent with reduced collagen fibril content and dermal thinning in COL1A2-CCN1 mice.

Figure 2. Reduced production of COL-1 and impaired TGFβ signaling in fibroblasts from COL1A2-CCN1 mice.

Figure 2.

Open in a new tab

Fibroblasts from 6-month-old COL1A2-CCN1 mice and their CTRLs were cultured from dorsal skin. Fibroblasts from COL1A2-CCN1 and CTRL mice were analyzed for levels of (a) type I procollagen mRNA, (b) type I procollagen protein, (c) TGFβ induction of Smad3 phosphorylation, (d) TβRI and TβRII mRNA, and (e) TβRI and TβRII protein. mRNA and protein levels determined by real-time RT-PCR and western analysis, respectively. mRNA or protein levels were normalized to 36B4 (internal housekeeping gene control) or β-actin (loading control), respectively. Inset shows representative western blots. Restoration of impaired TGFβ/Smad signaling by infecting COL1A2-CCN1 fibroblasts with TβRII-expressing adenovirus partially reversed the downregulation of COL-1 (f) mRNA and (g) protein expression. Mean ± SEM, n = 3 mice per genotype, *P < 0.05. COL-1, type I collagen; CTRL, nontransgenic littermate control; p-Smad3; phosphorylated Smad3; TβRI, type-I TGFβ receptor; TβRII, type-II TGFβ receptor.

The TGFβ pathway is the major regulator of dermal ECM production (Quan et al., 2010b). We investigated the potential involvement of TGFβ signaling in reduced expression of COL-1 in COL1A2-CCN1 mice fibroblasts. We first examined TGFβ-dependent Smad3 phosphorylation, which plays a critical role in type I procollagen gene expression (Lakos et al., 2004). Interestingly, TGFβ-dependent Smad3 phosphorylation was significantly lower in the dermal fibroblasts from COL1A2-CCN1 mice (Figure 2c). To elucidate the mechanism of impaired TGFβ signaling, we determined the gene expression of the major TGFβ pathway components, including TGFβ ligands, TGFβ receptors, and Smads. We found that levels of type-II TGFβ receptor (TβRII) mRNA (Figure 2d) and protein (Figure 2e) were selectively and significantly decreased by 57% and 70%, respectively, in COL1A2-CCN1 mice fibroblasts. In contrast, type-I TGFβ receptor expression (Figure 2d and e) and expression of other TGFβ pathway components remained unchanged (Supplementary Figure S3). Next, we tested the possibility that prevention of TβRII reduction should counteract impaired TGFβ signaling and thereby prevents the downregulation of COL-1. We found that restoration of impaired TGFβ/Smad signaling by infecting COL1A2-CCN1 fibroblasts with TβRII-expressing adenovirus partially reversed the downregulation of COL-1 mRNA (Figures 2f) and protein (Figure 2g) expression.

These data support the conclusion that specific downregulation of TβRII impairs TGFβ/Smad signaling, which leads to a reduction of COL-1 in COL1A2-CCN1 mice fibroblasts. Consistent with this finding, we previously reported that TGFβ signaling is decreased in aged human skin, largely owing to a reduction in TβRII (Fisher et al., 2016; Quan et al., 2006). Given that the TGFβ pathway is the major regulator of collagen production, it is likely that reduced collagen production and attendant dermal thinning in COL1A2-CCN1 mice is mediated, at least in part, by impaired TGFβ signaling in dermal fibroblasts.

Impairment of TGFβ signaling due to loss of TβRII in stromal fibroblasts results in epithelial tumors in animal models (Achyut et al., 2013). In the case of skin cancer, UV irradiation from the sun is thought to be the major risk factor. As it relates to this study, UV irradiation simultaneously induces CCN1 (~15-fold) (Quan et al., 2010a) and inhibits the expression of TβRII (reduced by ~70%) in human skin dermal fibroblasts both in vivo and in vitro (Quan et al., 2004). These data suggest that a concomitant increase of CCN1 and reduction of TβRII in aged dermal fibroblasts could promote age-related keratinocyte skin cancer, which is the most common cancer in adult Caucasians (Mackiewicz-Wysocka et al., 2013).

Elevated MMP expression contributes to dermal collagen fibril damage in COL1A2-CCN1 mice

We next explored the potential mechanisms leading to the fragmentation of collagen fibrils in COL1A2-CCN1 mice. We measured proteolytic activity in conditioned media from COL1A2-CCN1 and nontransgenic littermate fibroblasts by collagen zymography. As shown in Figure 3a, COL1A2-CCN1 mice fibroblasts expressed significantly greater proteolytic activity than control fibroblasts. The family of mammalian MMPs is primarily responsible for the degradation of the collagen-rich ECM. Therefore, we examined the ability of the MMP inhibitor GM6001 to suppress proteolytic activity in COL1A2-CCN1 mice fibroblast‒conditioned media. GM6001 substantially inhibited COL1A2-CCN1 mice fibroblast proteolytic activity in a dose-dependent manner (Figure 3a). This suppression suggests that COL1A2-CCN1 mice fibroblasts express increased levels of MMPs. To ascertain which MMP family members are expressed by COL1A2-CCN1 mice fibroblasts, we determined the gene expression levels of the 24 mammalian MMPs. We found that the expression of MMP-9, MMP-10, MMP-13, MMP-24, and MMP-27 were significantly elevated in the fibroblasts from COL1A2-CCN1 mice compared with those in the control fibroblasts (Figure 3b). Importantly, these changes resemble those in aged human skin, in which elevated CCN1 upregulates the expression of MMPs (Qin et al., 2013; Quan et al., 2011).

Figure 3. Fibroblasts from COL1A2-CCN1 mice express elevated levels of collagen-degrading MMPs.

Figure 3.

Open in a new tab

(a, b) Fibroblasts from the dorsal skin of 6-month-old COL1A2-CCN1 mice and CTRLs were cultured in monolayer. (a) Proteolytic activities in fibroblast-conditioned media were examined by zymography. Areas of protease activity appear as clear bands. Inhibition of proteolytic activity by MMP inhibitor GM6001 identified the presence of MMP proteolytic activity. rhMMP-1 was used as a positive control. (b) MMP mRNA levels were determined by real-time RT-PCR. Levels were normalized to 36B4 (internal housekeeping gene control). (c, d) Fibroblasts from COL1A2-CCN1 and CTRL mice were cultured in 3D-collagen lattices, and the structure of the collagen fibrils was examined by AFM in different treatment conditions. (c) The red arrows indicate intact collagen fibrils, and blue arrowheads indicate damaged collagen fibrils. (d) Collagen fibril organization, measured by Ra, was quantified using Nanoscope Analysis software (Nanoscope_Analysis_v120R1sr3, Bruker-AXS, Santa Barbara, CA). All data are expressed as mean ± SEM, n = 3 mice per genotype, *P < 0.05. 3D, three-dimensional; AFM, atomic force microscopy; CTRL, nontransgenic littermate control; MMP, matrix metalloproteinase; Ra, average roughness; rhMMP, recombinant human MMP

MMP-13, or collagenase-3, can initiate COL-1 fibril degradation by cleavage at a single site within the triple helix to generate 3 of 4 and 1 of 4 length fragments (Stickens et al., 2004). The fragments can be further degraded by MMP-9, also known as gelatinase B (Fanjul-Fernández et al., 2010). MMP-10, or stromelysin-2, degrades other ECM components as well as activates proMMP-13 and proMMP-9 by limited proteolysis (Nakamura et al., 1998). MMP-24 and MMP-27 are relatively less well-characterized. MMP-27 contains a transmembrane domain with a unique C-terminal extension that promotes its retention in the endoplasmic reticulum (Cominelli et al., 2014), whereas MMP-24 is a membrane-type MMP, also known as membrane-type 5 MMP, which can activate pro-gelatinase A (proMMP-2) in tumors (Llano et al., 1999). Therefore, COL1A2-CCN1 fibroblasts express elevated levels of MMPs that together can initiate and further degrade COL-1 fibrils.

We next cultured COL1A2-CCN1 and control littermate fibroblasts in three-dimensional (3D) collagen lattices and examined collagen fibril fragmentation by AFM. AFM images revealed that collagen fibrils in lattices containing control fibroblasts were intact and well-organized, displaying characteristic periodic D-banding (Figure 3c, left panel). In contrast, collagen fibrils in lattices containing COL1A2-CCN1 mice fibroblasts were fragmented and disorganized (Figure 3c, middle left), similar to collagen fibrils in lattices treated with recombinant human MMP-1 (Figure 3c, right panel). COL1A2-CCN1 mice fibroblast‒mediated collagen fibril disruption was blocked by GM6001 (Figure 3c, middle right).

AFM 3D surface topography mapping indicated that collagen fibrils in lattices containing COL1A2-CCN1 mice fibroblasts were more disorganized (Figure 3d). Quantitative analysis of AFM data indicated that the average roughness (a measure of fibril organization) of collagen fibrils in lattices containing COL1A2-CCN1 mice fibroblasts was two-fold greater than lattices containing control fibroblasts (66 nm vs. 127 nm).

c-Jun/AP-1 contributes to dermal collagen damage in COL1A2-CCN1 mice through the elevation of MMPs

Three of the five MMPs that are elevated in COL1A2-CCN1 mice fibroblasts (MMP-9, MMP-10, and MMP-13) are regulated by the transcription factor AP-1 (Benbow and Brinckerhoff, 1997). We determined the expression of c-Jun, a component of AP-1, and found significant increases in c-Jun mRNA (Figure 4a) and protein (Figure 4b). In addition, AP-1 transcriptional activity, measured by a luciferase reporter, was elevated four-fold in COL1A2-CCN1 mice fibroblasts (Figure 4c). Importantly, we found that knockdown of c-Jun by two different c-Jun small interfering RNAs (siRNAs) (Supplementary Figure S4) partially reversed the upregulation of multiple MMPs (Figure 4d). We have previously reported that multiple MMPs increase with age in the human dermis (Fisher et al., 2009; Quan et al., 2009), and this increase is associated with elevated expression of c-Jun/AP-1 (Qin et al., 2014). Taken together, these data indicate that CCN1 induction of MMPs likely involves the upregulation of c-Jun/AP-1.

Figure 4. c-Jun/AP-1 contributes to dermal damage in COL1A2-CCN1 mice through the elevation of MMPs.

Figure 4.

Open in a new tab

Fibroblasts from the dorsal skin of 6-month-old CTRL and COL1A2-CCN1 mice were cultured in monolayer. (a) c-Jun mRNA and (b) c-Jun protein levels were determined by real-time RT-PCR and western analysis, respectively. Levels were normalized to 36B4 (internal housekeeping gene control) and β-actin (loading control). Inset shows the representative western blots. (c) An AP-1 reporter construct (pAP1-TA-Luc) was transiently transfected by electroporation into CTRL and COL1A2-CCN1 fibroblasts. After 48 hours, luciferase activity was measured to determine AP-1 activity. (d) Knockdown of c-Jun by c-Jun siRNA partially reversed the upregulation of multiple MMPs. Fibroblasts from 6-month-old COL1A2-CCN1 mice were transiently transfected with control siRNA (CTRL) or c-Jun siRNA #1 or #2 by electroporation. Cells were harvested at 48 hours after transfection and analyzed for MMP mRNA levels by real-time RT-PCR. Levels normalized to 36B4 (internal housekeeping gene control). All data are expressed as mean ± SEM, n = 3, *P < 0.05 versus CTRL. (e) Model showing mechanisms by which elevated CCN1 leads to dermal ECM aging. All data are expressed as mean ± SEM, n = 3 mice per genotype, *P < 0.05 versus CTRL. AP-1, activator protein 1; COL1A2-tg, COL1A2-transgene; CTRL, nontransgenic littermate control; MMP, matrix metalloproteinase; siRNA, small interfering RNA; TβRII, type-II TGFβ receptor.

Our data demonstrate that CCN1 is specifically expressed in dermal fibroblasts in mouse skin. The major histological alterations of the epidermis in aged human skin are flattening of the rete ridges and thinning of the epidermis. We did not observe significant histological epidermal alterations in our COL1A2-CCN1 mice, although normal mouse epidermis is relatively thin and generally lacks distinct rete ridges, making changes in these features difficult to access. Human aging also results in graying and thinning of hair. We have not observed a hair phenotype in our COL1A2-CCN1 mice. As such, COL1A2-CCN1 mice are primarily a model of accelerated dermal aging.

It is possible that the COL1A2-CCN1 cassette that drives CCN1 expression in dermal fibroblasts may express CCN1 in collagen-producing cells in tissues other than the skin. To investigate the potential effects of CCN1 transgene expression in tissues other than the skin, we performed a detailed necropsy of all organs. Histopathological examination did not reveal significant alterations in the connective tissues or other tissues (brain, lungs, heart, liver, kidneys, skeletal muscle, joint, bone, tendon) that distinguished wild-type control littermates from COL1A2-CCN1 mice (Supplementary Table S1).

In summary, we demonstrate that the selective expression of CCN1 in dermal fibroblasts drives an accelerated aged phenotype in the dermis that closely resembles human aging (Figure 4e). This finding supports a causal link between CCN1 and skin dermal aging. The mechanism by which CCN1 acts is indirect, likely initiated by integrin outside-in signaling (Chen et al., 2007) leading to MAPK pathway activation and biosynthesis of effectors (Chen et al., 2001) such as AP-1. The COL1A2-CCN1 mouse model provides a unique opportunity to identify and investigate initial molecular mechanisms and early markers of skin dermal aging. Such studies could lead to the development of novel preventative and ameliorative therapeutic strategies to improve skin health and reduce age-related maladies in the elderly.

MATERIALS AND METHODS

Generation of COL1A2-CCN1 transgenic mice

The COL1A2-CCN1 transgenic mice used in this study were produced by standard pronuclear injection of linear DNA into a fertilized mouse egg (C57BL/6, Jackson Labs, Bar Harbor, ME) at the University of Michigan Transgenic Core. Briefly, a Sal1 fragment containing the human CCN1 was PCR amplified and cloned in the plasmid pCD3 containing the 6-kilobase enhancer and promoter of the COL1A2 gene, an internal ribosome entry-site lacZ reporter, and the murine protamine polyA signal (Bou-Gharios et al., 1996; Sonnylal et al., 2010). All cloning was verified by sequencing. Integration of the CCN1 transgene was assessed by genotyping of mouse tail DNA with specific primers for CCN1 transgene (5′-AAC-CCT-GAG-TGC-CGC-CTT-GTG-AAA-3′ and 5′-ATT-GGC-ATG-CGG-GCA-GTT-GTA-GTT-3′) and mouse β-globin (5′-CCA-ATC-TGC-TCA-CAC-AGG-ATA-GAG-AGG-GCA-GG-3′ and 5′-CCT-TGA-GGC-TGT-CCA-AGT-GAT-TCA-GGC-CAT-CG-3′) as a positive control. The COL1A2-CCN1 founders were crossed with C57BL/6 background breeders (Jackson Labs) for at least six generations. All experiments were performed in 6-month-old sex-matched mice. Three lines with a similar expression of CCN1 transgene (Supplementary Figure S1c) were used for the studies presented in this report. All protocols for mouse experimentation were approved by the University of Michigan Institutional Animal Care and Use Committee.

Histology and immunohistology

Mouse skin was embedded in optimal cutting temperature, and cryosections (7 μm) were stained with H&E, Masson’s trichrome, or Sirius red by the standard procedures. The dermal thickness and collagen density (blue in Masson’s trichrome and red in Sirius red) were quantified by computerized image analysis (Image-pro Plus software, version 4.1, Media Cybernetics, Rockville, MD). Immunohistology was performed as described previously using antibodies against CCN1 (Santa Cruz Biotechnology, Santa Cruz, CA) (Quan et al., 2006) and type I procollagen (EMD Millipore, Temecula, CA). Briefly, skin samples embedded in optimal cutting temperature were sectioned (7 μm), fixed in 2% paraformaldehyde, permeabilized with 0.5% Triton X-100 in PBS, blocked with rabbit serum (5% in PBS), and incubated for 1 hour at room temperature with primary antibodies, followed by incubation with secondary antibody for 1 hour at room temperature. After staining, the slides were examined using a digital imaging microscope (Zeiss, Germany). The specificity of staining was determined by substituting isotype-control immunoglobulin (mouse IgG2a) for the primary antibodies. No detectable staining was observed with isotype controls.

AFM imaging

Mouse skin biopsies and 3D collagen lattices were embedded in optimal cutting temperature, and cryosections (15 μm) were mounted on microscope cover glass (1.2 mm diameter, Fisher Scientific, Pittsburgh, PA) for AFM image analysis. AFM images were acquired using a Dimension Icon AFM system (Bruker-AXS, Madison, WI) in the air using a silicon-etched cantilever (NSC15/AIBS, MikroMasch, San Jose, CA) with a full tip cone angle of ~40 ° and the tip radius of curvature of ~10 nm. AFM images were acquired at a scan rate of 0.977 Hz, 512 × 512 pixel resolutions, as previously described (Qin et al., 2014). Collagen fibril’s average roughness was analyzed using Nanoscope Analysis software (Nanoscope Analysis v120R1sr3 Bruker-AXS, Santa Barbara, CA). AFM images were obtained from the Electron Microbeam Analysis Laboratory, University of Michigan College of Engineering, and analyzed using Nanoscope Analysis software (Bruker-AXS).

Cell culture, RNA isolation, and quantitative real-time PCR

Mouse dorsal skin was washed with cold PBS and sterilized with 70% ethanol twice. The skin tissue was placed in an empty 100 mm petridish and then dissected and minced with surgical scissors using sterile techniques under the hood. The tissue was placed in a flask and was incubated with 10 ml of 0.25% trypsinizing solution (Sigma Chemical, St. Louis, MO) and 0.02% EDTA (Sigma Chemical) at room temperature for 15 minutes. The trypsinizing solution was replaced with a fresh solution (10 ml) and incubated for 1 hour. Isolated cells were collected after brief centrifugation and resuspended in DMEM (Life Technology, Grand Island, NY) supplemented with 10% fetal bovine serum (Sigma Chemical), penicillin (100 U/ml), and streptomycin (100 μg/ml) in a humidified incubator with 5% carbon dioxide at 37 °C. Cells were cultured at subconfluence and utilized between passages 2 and 4. Total RNA was isolated from mouse skin punch biopsy and dermal fibroblasts using a commercial kit (RNeasy mini kit, Qiagen, Chatsworth, CA) according to the manufacturer’s instructions. PCR template was prepared by reverse transcription using the Taqman Reverse Transcription kit (Applied Biosystems, Foster City, CA). PCR was performed in duplicate with 2 μl of cDNA for the genes of interest using the TaqMan Universal PCR Master Mix kit (Applied Bio-systems) and a 7300 sequence detector system (Applied Biosystems). PCR procedures were performed with a robotic workstation (Biomek 2000; Beckman Coulter, Hialeah, FL) to ensure accuracy and reproducibility. Type I procollagen and MMP mRNA levels were normalized to the mRNA levels of the housekeeping gene, 36B4 (internal control). Type I procollagen and MMP primers were purchased from Real-Time Primers (Elkins Park, PA). The human CCN1 primers were sense primers: 5′-TCAAA-GACCTGTGGAACTGGTATC-3′ and anti-sense primer: 5′−CACAAATCC-GGGTTTCTTTCA-3′.

Western blot analysis

Whole-cell proteins were extracted, and equal amounts of protein (~40 μg per lane) were resolved by 6–12% gradient SDS gel electrophoresis and transferred to polyvinylidene difluoride membranes. Membranes were then blocked with 0.1% Tween 20 in PBS containing 5% nonfat milk for 1 hour at room temperature. Primary antibodies were incubated for 1 hour at room temperature. The following antibodies were used for western blotting: type I procollagen (EMD Millipore), phosphorylated Smad3 (Cell Signaling Technology, Danvers, MA), total Smad3, CCN1, type-I TGFβ receptor, TβRII, c-Jun (Santa Cruz Biotechnology), and β-actin (Sigma). The membranes were washed three times with 0.1% Tween 20 in PBS solution and incubated with appropriate secondary antibodies for 1 hour at room temperature. After washing three times with 0.1% Tween 20 in PBS, the membranes were developed with ECF (Vistra ECF Western blotting system, GE Health Care, Piscataway, NJ) according to the manufacturer’s instructions. The membranes were scanned with a Storm PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and the intensities of each band were quantified using ImageQuant software (GE Health Care) and normalized to β-actin (control). Full-size western blots are provided in Supplementary Figure S5.

Adenovirus infection, siRNA transfection, and AP-1 reporter assay

TβRII adenovirus was purchased from Applied Biological Materials (Richmond, British Columbia, Canada). TβRII adenovirus was amplified by transducing human embryonic kidney293 cells and infected cells according to the manufacture’s instruction. Control adenovirus was obtained from the University of Michigan Medical School Biomedical Research Core. Control nonsilencing siRNA (AATTCTCCGAACGTGTCACGT) and c-Jun siRNA#1 (AAAGTCAT-GAACCACGTTAA) were purchased from Qiagen (Germantown, MD). c-Jun siRNA#2 (AACTCATGCTAACGCAGCAGT) was purchased from Xeragon (Germantown, MD). AP-1 reporter construct (pAP1-TA-Luc) was purchased from BD Biosciences Clontech (Palo Alto, CA). Mouse skin fibroblasts were transiently transfected with siRNAs or AP-1 reporter construct for 48 hours by electroporation using dermal fibroblasts nucleofector kit (Amaxa Biosystems, Gaithersburg, MD) according to the manufacturer’s instructions. Luciferase activity was measured by luciferase assay using an enhanced luciferase assay kit (PharMingen International, San Diego, CA) according to the manufacturer’s instructions. Aliquots containing identical β-galactosidase activity were used for each luciferase assay.

3D collagen cultures and zymography assay

3D collagen gels were prepared on the basis of a previous publication with minor modifications (Qin et al., 2014). Briefly, rat tail COL-1 (2 mg/ml, BD Biosciences) was suspended in a medium cocktail (DMEM, sodium bicarbonate [44 mM], L-glutamine [4 mM], Folic Acid [9 mM]) and neutralized with 1 N sodium hydroxide to pH 7.2. Cells (0.5 × 106) were suspended in 2 ml collagen and medium cocktail solution and plated in a 35 mm bacterial culture dish. The collagen gels were placed in an incubator at 37 °C for 30 minutes to allow collagen polymerization. The collagen gels were then incubated with 2 ml media (DMEM, 10% fetal bovine serum) at 37 °C and 5% carbon dioxide. To activate secreted MMP-1, collagen lattices were washed extensively with PBS (at least three times for 30 minutes) and then treated with Trypsin-EDTA (100 ng/ml, Invitrogen Life Technology, Carlsbad, CA) in serum-free media for 24–36 hours. 3D collagen gels were embedded in optimal-cutting temperature, and cryosections (15 μm) were analyzed for collagen fragmentation by AFM image analysis. For zymography assays, conditioned media from the cultured cells were concentrated and then analyzed by electrophoresis in the presence of 12% Zymogram (collagen) protein gel (Thermo Fisher Scientific, Waltham, MA). After electrophoresis, the gel was incubated in Zymogram renaturing buffer (Thermo Fisher Scientific) for 30 minutes at room temperature with gentle agitation. After renaturing, the gel was incubated in developing buffer (Thermo Fisher Scientific) at 37 °C overnight. The MMP activities were visualized by staining Coommasie Blue R-250 (Thermo Fisher Scientific) solution. MMP inhibitor (GM6001, Santa Cruz Biotechnology) was used to test MMP-mediated proteolytic activity.

Supplementary Material

1

ACKNOWLEDGMENTS

We thank Diane Fiolek for administrative assistance as well as Joel Maust for writing and/or editorial support. We thank Ingrid Bergin VDM, Pathologist and Director, In Vivo Animal Core, Unit for Laboratory Animal Medicine, University of Michigan (Ann Arbor, MI), for performing mouse necropsy. We also thank the University of Michigan Transgenic Core for the production of COL1A2-CCN1 mice and Shonali Majumdar (University of Texas MD Anderson Cancer Center, Houston, TX) for the pCD3 plasmid containing the 6-kilobases enhancer and promoter of the Col1a2 gene. This work was supported by the National Institutes of Health (AG054835 to GJF and TQ). The protocols for mouse experimentation were approved by the University of Michigan Institutional Animal Care and Use Committee.

Abbreviations:

3D

three-dimensional

AFM

atomic force microscopy

AP-1

activator protein 1

COL-1

type I collagen

ECM

extracellular matrix

MMP

matrix metalloproteinase

siRNA

small interfering RNA

TβRII

type-II TGFβ receptor

Footnotes

CONFLICT OF INTEREST

The authors state no conflicts of interest.

SUPPLEMENTARY MATERIAL

Supplementary material is linked to the online version of the paper at www.jidonline.org, and at https://doi.org/10.1016/j.jid.2020.07.019.

Statistical analysis

Data are expressed as mean ± SEM. Comparisons were made with the unpaired t-test (two groups). ANOVA test was performed for multiple comparisons. All P-values are two tailed and considered significant when <0.05.

Data availability statement

The authors confirm that the data supporting the findings of this study are available in the article and its Supplementary Materials. There were no datasets used in this study.

REFERENCES

  1. Achyut BR, Bader DA, Robles AI, Wangsa D, Harris CC, Ried T, et al. Inflammation-mediated genetic and epigenetic alterations drive cancer development in the neighboring epithelium upon stromal abrogation of TGF-β signaling. PLoS Genet 2013;9:e1003251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ayer-Lelievre C, Brigstock D, Lau L, Pennica D, Perbal B, Yeger H. Report and abstracts on the first international workshop on the CCN family of genes. Mol Pathol 2001;54:105–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beauregard S, Gilchrest BA. A survey of skin problems and skin care regimens in the elderly. Arch Dermatol 1987;123:1638–43. [PubMed] [Google Scholar]
  4. Benbow U, Brinckerhoff CE. The AP-1 site and MMP gene regulation: what is all the fuss about? Matrix Biol 1997;15:519–26. [DOI] [PubMed] [Google Scholar]
  5. Bou-Gharios G, Garrett LA, Rossert J, Niederreither K, Eberspaecher H, Smith C, et al. A potent far-upstream enhancer in the mouse pro alpha 2(I) collagen gene regulates expression of reporter genes in transgenic mice. J Cell Biol 1996;134:1333–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen CC, Mo FE, Lau LF. The angiogenic factor Cyr61 activates a genetic program for wound healing in human skin fibroblasts. J Biol Chem 2001;276:47329–37. [DOI] [PubMed] [Google Scholar]
  7. Chen CC, Young JL, Monzon RI, Chen N, Todorović V, Lau LF. Cytotoxicity of TNFalpha is regulated by integrin-mediated matrix signaling. EMBO J 2007;26:1257–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chen N, Chen CC, Lau LF. Adhesion of human skin fibroblasts to Cyr61 is mediated through integrin alpha 6beta 1 and cell surface heparan sulfate proteoglycans. J Biol Chem 2000;275:24953–61. [DOI] [PubMed] [Google Scholar]
  9. Cominelli A, Halbout M, N’Kuli F, Lemoine P, Courtoy PJ, Marbaix E, et al. A unique C-terminal domain allows retention of matrix metalloproteinase- 27 in the endoplasmic reticulum. Traffic 2014;15:401–17. [DOI] [PubMed] [Google Scholar]
  10. Dosoki H, Stegemann A, Taha M, Schnittler H, Luger TA, Schröder K, et al. Targeting of NADPH oxidase in vitro and in vivo suppresses fibroblast activation and experimental skin fibrosis. Exp Dermatol 2017;26:73–81. [DOI] [PubMed] [Google Scholar]
  11. Eaglstein WH. Wound healing and aging. Clin Geriatr Med 1989;5:183–8. [PubMed] [Google Scholar]
  12. Fanjul-Fernández M, Folgueras AR, Cabrera S, López-Otín C. Matrix metalloproteinases: evolution, gene regulation and functional analysis in mouse models. Biochim Biophys Acta 2010;1803:3–19. [DOI] [PubMed] [Google Scholar]
  13. Fisher GJ, Quan T, Purohit T, Shao Y, Cho MK, He T, et al. Collagen fragmentation promotes oxidative stress and elevates matrix metalloproteinase-1 in fibroblasts in aged human skin. Am J Pathol 2009;174:101–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fisher GJ, Shao Y, He T, Qin Z, Perry D, Voorhees JJ, et al. Reduction of fibroblast size/mechanical force down-regulates TGF-beta type II receptor: implications for human skin aging. Aging Cell 2016;15:67–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. He T, Quan T, Shao Y, Voorhees JJ, Fisher GJ. Oxidative exposure impairs TGF-β pathway via reduction of type II receptor and SMAD3 in human skin fibroblasts. Age (Dordr) 2014;36:9623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jacob MP. Extracellular matrix remodeling and matrix metalloproteinases in the vascular wall during aging and in pathological conditions. Biomed Pharmacother 2003;57:195–202. [DOI] [PubMed] [Google Scholar]
  17. Jun JI, Lau LF. Taking aim at the extracellular matrix: CCN proteins as emerging therapeutic targets. Nat Rev Drug Discov 2011;10:945–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kennedy BK, Berger SL, Brunet A, Campisi J, Cuervo AM, Epel ES, et al. Geroscience: linking aging to chronic disease. Cell 2014;159:709–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lakos G, Takagawa S, Chen SJ, Ferreira AM, Han G, Masuda K, et al. Targeted disruption of TGF-beta/Smad3 signaling modulates skin fibrosis in a mouse model of scleroderma. Am J Pathol 2004;165:203–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lau LF. CCN1/CYR61: the very model of a modern matricellular protein. Cell Mol Life Sci 2011;68:3149–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Llano E, Pendás AM, Freije JP, Nakano A, Knaüper V, Murphy G, et al. Identification and characterization of human MT5-MMP, a new membrane-bound activator of progelatinase a overexpressed in brain tumors. Cancer Res 1999;59:2570–6. [PubMed] [Google Scholar]
  22. Ma W, Wlaschek M, Tantcheva-Poór I, Schneider LA, Naderi L, Razi-Wolf Z, et al. Chronological ageing and photoageing of the fibroblasts and the dermal connective tissue. Clin Exp Dermatol 2001;26:592–9. [DOI] [PubMed] [Google Scholar]
  23. Mackiewicz-Wysocka M, Bowszyc-Dmochowska M, Strzelecka-Węklar D, Dańczak-Pazdrowska A, Adamski Z. Basal cell carcinoma - diagnosis. Contemp Oncol (Pozn) 2013;17:337–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mo FE, Muntean AG, Chen CC, Stolz DB, Watkins SC, Lau LF. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol 2002;22:8709–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Nakamura H, Fujii Y, Ohuchi E, Yamamoto E, Okada Y. Activation of the precursor of human stromelysin 2 and its interactions with other matrix metalloproteinases. Eur J Biochem 1998;253:67–75. [DOI] [PubMed] [Google Scholar]
  26. Plant AL, Bhadriraju K, Spurlin TA, Elliott JT. Cell response to matrix mechanics: focus on collagen. Biochim Biophys Acta 2009;1793:893–902. [DOI] [PubMed] [Google Scholar]
  27. Qin Z, Fisher GJ, Quan T. Cysteine-rich protein 61 (CCN1) domain-specific stimulation of matrix metalloproteinase-1 expression through αVβ3 integrin in human skin fibroblasts. J Biol Chem 2013;288:12386–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Qin Z, Okubo T, Voorhees JJ, Fisher GJ, Quan T. Elevated cysteine-rich protein 61 (CCN1) promotes skin aging via upregulation of IL-1β in chronically sun-exposed human skin. Age (Dordr) 2014;36:353–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Quan T, He T, Kang S, Voorhees JJ, Fisher GJ. Solar ultraviolet irradiation reduces collagen in photoaged human skin by blocking transforming growth factor-β type II receptor/Smad signaling. Am J Pathol 2004;165: 741–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Quan T, He T, Shao Y, Lin L, Kang S, Voorhees JJ, et al. Elevated cysteine-rich 61 mediates aberrant collagen homeostasis in chronologically aged and photoaged human skin. Am J Pathol 2006;169:482–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Quan T, Qin Z, Robichaud P, Voorhees JJ, Fisher GJ. CCN1 contributes to skin connective tissue aging by inducing age-associated secretory phenotype in human skin dermal fibroblasts. J Cell Commun Signal 2011;5:201–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Quan T, Qin Z, Xia W, Shao Y, Voorhees JJ, Fisher GJ. Matrix-degrading metalloproteinases in photoaging. J Investig Dermatol Symp Proc 2009;14: 20–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Quan T, Qin Z, Xu Y, He T, Kang S, Voorhees JJ, et al. Ultraviolet irradiation induces CYR61/CCN1, a mediator of collagen homeostasis, through activation of transcription factor AP-1 in human skin fibroblasts. J Invest Dermatol 2010a;130:1697–706. [DOI] [PubMed] [Google Scholar]
  34. Quan T, Shao Y, He T, Voorhees JJ, Fisher GJ. Reduced expression of connective tissue growth factor (CTGF/CCN2) mediates collagen loss in chronologically aged human skin. J Invest Dermatol 2010b;130:415–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rogers HW, Weinstock MA, Feldman SR, Coldiron BM. Incidence estimate of nonmelanoma skin cancer (keratinocyte carcinomas) in the U.S. population, 2012. JAMA Dermatol 2015;151:1081–6. [DOI] [PubMed] [Google Scholar]
  36. Smith JG Jr, Davidson EA, Sams WM Jr, Clark RD. Alterations in human dermal connective tissue with age and chronic sun damage. J Invest Dermatol 1962;39:347–50. [DOI] [PubMed] [Google Scholar]
  37. Sonnylal S, Shi-Wen X, Leoni P, Naff K, Van Pelt CS, Nakamura H, et al. Selective expression of connective tissue growth factor in fibroblasts in vivo promotes systemic tissue fibrosis. Arthritis Rheum 2010;62: 1523–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Stickens D, Behonick DJ, Ortega N, Heyer B, Hartenstein B, Yu Y, et al. Altered endochondral bone development in matrix metalloproteinase 13-deficient mice. Development 2004;131:5883–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sweeney SM, Orgel JP, Fertala A, McAuliffe JD, Turner KR, Di Lullo GA, et al. Candidate cell and matrix interaction domains on the collagen fibril, the predominant protein of vertebrates. J Biol Chem 2008;283: 21187–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Wermuth PJ, Mendoza FA, Jimenez SA. Abrogation of transforming growth factor-beta-induced tissue fibrosis in mice with a global genetic deletion of Nox4. Lab Invest 2019;99:470–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yaar M, Gilchrest BA. Skin aging: postulated mechanisms and consequent changes in structure and function. Clin Geriatr Med 2001;17:617–30. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1621326-supplement-1.pdf (1.8MB, pdf)

RESOURCES