KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Guinea Pig Polyclonal Anti-Insulin | Agilent | Cat#A056401-2; RRID: AB_2617169 |
| Rabbit Polyclonal Anti-Glucagon | Cell Signaling Technology | Cat#2760; RRID: AB_659831 |
| Rabbit Monoclonal Anti-MAFA | Cell Signaling Technology | Cat#79737; RRID: AB_2799938 |
| Rabbit Polyclonal Anti-Urocortin III | Phoenix Pharmaceuticals | Cat#H-019-29 |
| Rabbit Polyclonal Anti-GLUT-2 | Sigma-Aldrich | Cat#07-1402; RRID: AB_1587076 |
| Rabbit Monoclonal Anti-Ki-67 | Cell Signaling Technology | Cat#9129; RRID: AB_2687446 |
| Alexa Fluor 488 AffiniPure Donkey Anti-Rabbit IgG (H+L) | Jackson ImmunoResearch | Cat#711-545-152; RRID: AB_2313584 |
| Alexa Fluor 647 AffiniPure Donkey Anti-Guinea Pig IgG (H+L) | Jackson ImmunoResearch | Cat#706-605-148; RRID: AB_2340476 |
| Chemicals, peptides, and recombinant proteins | ||
| RPMI-1640 cell culture media | Sigma-Aldrich | Cat#R8758 |
| Fetal bovine serum | Thermo Fisher | Cat#A31605 |
| Penicillin-Streptomycin (10,000U/mL) | Fisher Scientific | Cat#5140122 |
| SU9516 | Enzo Life Sciences | Cat#ALX-270-400; CAS: 377090-84-1 |
| SYBR Green PCR Master Mix | Thermo Fisher | Cat#4364346 |
| DMEM | Sigma-Aldrich | Cat#D5030 |
| Rat/Mouse Insulin Standard | Millipore | Cat#E8013-k |
| Streptavidin protein, HRP | Thermo Scientific | Cat#21126 |
| o-phenylenediamine | Millipore Sigma | Cat#P5412; CAS: 95-54-5 |
| FuraRed | Invitrogen | Cat#F3020; CAS: 179732-62-7 |
| Rhodamine-1,2,3 | Invitrogen | Cat#R302; CAS: 62669-70-9 |
| Amphotericin B | Sigma-Aldrich | Cat#A4888; CAS: 1397-89-3 |
| Diazoxide | Sigma-Aldrich | Cat#D9035; CAS: 364-98-7 |
| Accutase | Sigma-Aldrich | Cat#A6964 |
| Normal Donkey Serum | Jackson ImmunoResearch | Cat#017-000-121; RRID: AB_2337258 |
| TEPP-46 (PKa) | MilliporeSigma | Cat#50-548-70001; CAS: 1221186-53-3 |
| Antimycin A | Sigma-Aldrich | Cat#A8674; CAS: 1397-94-0 |
| Valinomycin | Sigma-Aldrich | Cat#V0627; CAS: 2001-95-8 |
| Oligomycin | Sigma-Aldrich | Cat#75351; CAS: 579-13-5 |
| Potassium Cyanide | Sigma-Aldrich | Cat#60178; CAS: 151-50-8 |
| Coumarin | Sigma-Aldrich | Cat#C4261; CAS: 91-64-5 |
| Rotenone | Sigma-Aldrich | Cat#R8875; CAS: 83-79-4 |
| Critical commercial assays | ||
| RNeasy RNA extraction kit | QIAGEN | Cat#74104 |
| High-capacity cDNA Reverse Transcription Kit | Applied Biosystems | Cat#4368814 |
| Experimental models: organisms/strains | ||
| B6.Cg-Tg(Ins1-cre/ERT)1Lphi/J mice | The Jackson Laboratory | JAX: 024709 |
| Cdk2fl/fl mice | Jayapal et al., 2015 | N/A |
| C57BL/6J mice | The Jackson Laboratory | JAX: 000664 |
| Oligonucleotides | ||
| Primer: Cdk2 Forward: AATTCTTCTGGGCTGCAAGTA | This paper | N/A |
| Primer: Cdk2 Reverse: GGGTACACACTAGGTGCATTT | This paper | N/A |
| Primer: Kcnj11 Forward: GTGTCCAAGAAAGGCAACTG | This paper | N/A |
| Primer: Kcnj11 Reverse: GCACAGGAAGGACATGGTG | This paper | N/A |
| Primer: β-Actin Forward: GAGACCTTCAACACCCC | Bhalla et al., 2014 | N/A |
| Primer: β-Actin Reverse: GTGGTGGTGAAGCTGTAGCC | Bhalla et al., 2014 | N/A |
| Recombinant DNA | ||
| β-cell specific Laconic Lactate biosensor | Lewandowski et al., 2020 | N/A |
| Ad-CMV-Cre-IRES-GFP | Vector Biolabs | Cat#1710 |
| Software and algorithms | ||
| NIS-Elements | Nikon Instruments | https://www.microscope.healthcare.nikon.com/products/software/nis-elements |
| MATLAB Software | Mathworks | https://www.mathworks.com/products/matlab.html |
| FIJI | ImageJ | https://imagej.net/Fiji |
| Axon pClamp 10 software | Axon Instruments/Molecular Devices | https://support.moleculardevices.com/s/article/Axon-pCLAMP-10-Electrophysiology-Data-Acquisition-Analysis-Software-Download-Page |
| GraphPad Prism 7.0 | Graphpad Software | https://www.graphpad.com/scientific-software/prism/ |
| Other | ||
| StepOne Plus Real-Time PCR System | Applied Biosystems | Cat#4376600 |
| Plate Reader Infinite M1000 Pro | TECAN | Cat#30063849 |
| 10X/0.5NA SuperFluor Objective | Nikon Instruments | Cat#MRF00100 |
| 60X/1.4NA Plan Apochromat Objective | Nikon Instruments | Cat#MRD01605 |
| SOLA SE-5-LCR-VA | Lumencor | N/A |
| FF444/521/608-Di01 dichroic beamsplitter | Semrock | Cat#FF444/521/608-Di01-25x36 |
| ORCA-Flash4.0 V2 | Hamamatsu | Cat#C11440-22CU |
| HEKA EPC10 patch-clamp amplifier | Heka | N/A |
| MaiTai HP DeepSee TI:Sapphire Laser | Spectra-Physics | N/A |
| Time-Correlated Single Photon Counting module | Becker & Hickl | Cat#SPC-830 |
| Photo Sensor Module | Hamamatsu | Cat#H7422P-40 |