Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for HDAC11 knockout mouse genotyping and HDAC11 exon qRT-PCR
| Purpose | Primer name | Sequence |
|---|---|---|
| Genotyping | Primer 1 forward | CTGTGGAGGGAGAGTTGCTC |
| Genotyping | Primer 1 reverse | GTTGAGATAGCGCCTCGTGT |
| Genotyping | Primer 2 reverse | GTGGACAGGACAAGGGCTAA |
| Genotyping | H11 promoter forward | GAGGCGTGTGTTCTGCGTA |
| Genotyping | eGFP reverse | GTAGGTCAGGGTGGTCACGA |
| qRT-PCR | H11 exon 3 forward | AGAGAAGCTGCTGTCCGATG |
| qRT-PCR | H11 exon 3/4 reverse | AGGACCACTTCAGCTCGTTG |
| qRT-PCR | Mm_Hdac11_1_SG | (Qiagen) Exons 8–9 |
