Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of all primers.
| Primer name | Sequences (5′-3′) |
|---|---|
| GAPDH (homo sapiens) forward | ATTGTCAGCAATGCATCCTG |
| GAPDH (homo sapiens) reverse | ATGGACTGTGGTCATGAGCC |
| FASN (homo sapiens) forward | CAACTCACGCTCCGGAAA |
| FASN (homo sapiens) reverse | TGTGGATGCTGTCAAGGG |
FASN, fatty acid synthase.
