| Antibody |
Mouse monoclonal anti-Flag |
Sigma |
F1804; RRID: AB_262044
|
Western – 1:1000; IF – 1:200 |
| Antibody |
Rabbit polyclonal anti-H3 |
Abcam |
Ab12079; RRID: AB_298834
|
1:15,000 |
| Antibody |
Rabbit polyclonal anti-tubulin |
Sigma–Aldrich |
T1450; RRID:AB_261655
|
1:5000 |
| Antibody |
Goat polyclonal anti-rabbit |
Jackson Laboratories |
111035045; RRID:AB_2337938
|
1:15,000 |
| Antibody |
Sheep polyclonal anti-mouse |
GE Healthcare |
NA931; RRID:AB_772210
|
1:5000 |
| Antibody |
Rat monoclonal anti-Ollas |
Novus Biologicals |
NBP1-06713SS |
Western – 1:8,000; IF – 1:200 |
| Antibody |
Polyclonal donkey anti-rabbit, AlexaFluor 488 |
ThermoFisher |
A-21208 |
1:400 |
| Antibody |
Polyclonal goat anti-mouse, AlexaFluor 555 |
ThermoFisher |
A-21127 |
1:400 |
| Antibody |
Polyclonal goat anti-mouse IgG (IRDye 800 CW) |
LI-COR Biosciences |
925–32210; RRID:AB_621842
|
1:15,000 |
| Antibody |
Polyclonal goat anti-rabbit IgG (IRDye 680 RD) |
LI-COR Biosciences |
925–68071; RRID:AB_2721181
|
1:15,000 |
| Other |
DAPI |
ThermoFisher |
62248 |
0.5 µg/mL |
| Other |
Vectashield with DAPI |
Vector Laboratories |
H-1200; RRID:AB_2336790
|
|
| Other |
Roche Blocking Buffer |
Millipore Sigma |
11096176001 |
|
| Other |
Odyssey Blocking Buffer (TBS) |
LI-COR Biosciences |
927–50003 |
|
| Strain, strain background (E. coli) |
OP50 |
Shared Fermentation Facility, The Pennsylvania State University |
|
|
| Strain, strain background (E. coli) |
HB101 |
Shared Fermentation Facility, The Pennsylvania State University |
|
|
| Strain, strain background (E. coli) |
HT115 RNAi clones |
Kamath and Ahringer, 2003 |
|
|
| Other |
TriReagent |
ThermoFisher |
AM9738 |
|
| Other |
Benzonase |
Sigma–Aldrich |
E1014 |
1:1000 |
| Other |
RNA 5′ Polyphosphatase |
Illumina |
RP8092H |
|
| Other |
Multiscribe Reverse Transcriptase |
ThermoFisher |
4311235 |
|
| Other |
Absolute Blue SYBR Green |
ThermoFisher |
AB4166B |
|
| Other |
Dimethyl pimelimidate dihydrochloride |
Sigma–Aldrich |
D8388 |
|
| Other |
Protease inhibitor cocktail |
Roche |
4693159001 |
1:100 |
| Other |
Purelink RNAse A |
ThermoFisher |
12091021 |
1:10 |
| Other |
Pronase E |
Sigma–Aldrich |
7433–2 |
20 µg/mL |
| Other |
TaqMan Universal PCR Master Mix, No AmpErase UNG |
ThermoFisher |
4324018 |
|
| Sequence-based reagent |
U18 TaqMan probe |
ThermoFisher |
1764 |
TGGCAGTGATGATCACAAATCCGTGTTTCTGACAAGCGATTGACGATAGAAAACCGGCTGAGCCA |
| Sequence-based reagent |
21UR-1848 TaqMan probe |
ThermoFisher |
|
UAAAGGCAGAAUUUUAUCAAC |
| Sequence-based reagent |
21UR-2502 TaqMan probe |
ThermoFisher |
|
UGAAAUUGUAGUAGACUGCUG |
| Sequence-based reagent |
21UR-4807 TaqMan probe |
ThermoFisher |
|
UGGGUGAAUUCUGUCCCGAAC |
| Sequence-based reagent |
21UR-1258 TaqMan probe |
ThermoFisher |
|
UAGACUUGAGUUAGAACGGUU |
| Sequence-based reagent |
21UR-3142 TaqMan probe |
ThermoFisher |
|
GUAGGGUCGUCUCUUGAGAGC |
| Sequence-based reagent |
21UR-3766 TaqMan probe |
ThermoFisher |
|
UGGAAGCUUGAUGGAAAAUGC |
| Commercial assay kit |
NEBNext Multiplex Small RNA Library Prep Set for Illumina |
New England Biolabs |
E7330S |
|
| Other |
Small RNA-seq data |
This study |
GEO: GSE152831
|
|
| Other |
ChIP-seq data |
This study |
GEO: GSE152831
|
|
| Other |
Mass spec data |
This study |
GEO: GSE152831
|
|
| Strain, strain background (C. elegans) |
wild-type, Bristol isolate |
CGC |
N2 |
|
| Strain, strain background (C. elegans) |
prg-1(n4357) I |
CGC |
SX922 |
|
| Strain, strain background (C. elegans) |
snpc-1.3(xk27)[snpc-1.3(lof)] V |
This study |
QK171 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
fem-1(hc17) IV |
CGC |
BA17 |
|
| Strain, strain background (C. elegans) |
him-8(e1489) IV |
CGC |
CB1489 |
|
| Strain, strain background (C. elegans) |
snpc-1.3(xk28)[snpc-1.3 (1xtbs)] V |
This study |
QK172 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-1.3(xk29)[snpc-1.3 (2xtbs)] V |
This study |
QK173 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-1.3(xk30)[snpc-1.3 (3xtbs)] V |
This study |
QK174 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk31)[snpc-4::3xflag] I |
This study |
QK175 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk31)[snpc-4::3xflag] I; fem-1(hc17) IV |
This study |
QK176 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk31)[snpc-4::3xflag] I; him-8(e1489) IV |
This study |
QK177 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-1.3(xk27)[snpc-1.3(lof)] V; fem-1(hc17) IV |
This study |
QK178 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-1.3(xk27)[snpc-1.3(lof)] V; him-8(e1489) IV |
This study |
QK179 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
mals105[col-19::GFP] V |
Xantha Karp lab |
XV33 |
|
| Strain, strain background (C. elegans) |
snpc-1.3(xk27)[snpc-1.3(lof)] V; mals105 V |
This study |
QK180 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk31)[snpc-4::3xflag] I, snpc-1.3(xk27)[snpc-1.3(lof)] V |
This study |
QK181 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk23) I [snpc-4::aid::ollas] |
This study |
QK162 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk23) I; unc-11(ed3) III; ieSi38 IV |
This study |
QK163 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
unc-11(ed3) III; ieSi38 IV [sun-1p::TIR1::mRuby::sun-1 3' UTR + Crb-unc-119(+)] IV |
CGC |
CA1199 |
|
| Strain, strain background (C. elegans) |
glp-4(bn2) I |
CGC |
SS104 |
|
| Strain, strain background (C. elegans) |
snpc-1.3(xk32)[snpc-1.3a::3xflag] V |
This study |
QK182 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
glp-4(bn2) I; snpc-1.3(xk32)[snpc-1.3a::3xflag] V |
This study |
QK183 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-1.3(xk33)[snpc-1.3a::ollas] V |
This study |
QK184 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk31)[snpc-4::3xflag] I, snpc-1.3(xk33)[snpc-1.3a::ollas] V |
This study |
QK185 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
prde-1(xk34)[prde-1::ollas] V |
This study |
QK186 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk31)[snpc-4::3xflag] I; prde-1(xk34)[prde-1::ollas] V |
This study |
QK187 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk35)[snpc-4::ollas] I |
This study |
QK188 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk35)[snpc-4::ollas] I; snpc-1.3(xk32)[snpc-1.3a::3xflag] V |
This study |
QK189 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk31)[snpc-4::3xflag] I; snpc-1.3(xk29)[snpc-1.3 (2xtbs)] V |
This study |
QK190 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-4(xk23) I; unc-11(ed3) III; ieSi38 IV; snpc-1.3(xk32)[snpc-1.3a::3xflag] V |
This study |
QK191 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-1.3(xk36)[snpc-1.3a::3xflag(2xtbs)] V |
This study |
QK192 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
tra-1(xk37)[3xflag::tra-1] III |
This study |
QK193 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
tra-1(xk37)[3xflag::tra-1] III; snpc-1.3(xk28)[snpc-1.3 (1xtbs)] V |
This study |
QK194 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
tra-1(xk37)[3xflag::tra-1] III; snpc-1.3(xk29)[snpc-1.3 (2xtbs)] V |
This study |
QK195 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
tra-1(xk37)[3xflag::tra-1] III; snpc-1.3(xk30)[snpc-1.3 (3xtbs)] V |
This study |
QK196 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Strain, strain background (C. elegans) |
snpc-1.3(xk38) [snpc-1.3b::3xflag] V |
This study |
QK197 |
For CRISPR/Cas9 reagents and methodology, see Supplementary file 4 and Method details. |
| Software, algorithm |
bbmap 38.23 |
http://jgi.doe.gov/data-and-tools/bb-tools |
|
|
| Software, algorithm |
Bowtie 1.1.1 |
Langmead et al., 2009 |
|
|
| Software, algorithm |
Bowtie2 2.3.4.2 |
Langmead and Salzberg, 2012 |
|
|
| Software, algorithm |
CASHX 2.3 |
Fahlgren et al., 2009 |
|
|
| Software, algorithm |
deepTools 3.3.1 |
Ramírez et al., 2016 |
|
|
| Software, algorithm |
DESeq2 1.18.1 |
Love et al., 2014 |
|
|
| Software, algorithm |
DESeq2 1.26.0 |
Love et al., 2014 |
|
|
| Software, algorithm |
FastQC 0.11.7 |
http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
|
|
| Software, algorithm |
GraphPad Prism |
https://www.graphpad.com |
|
|
| Software, algorithm |
ImageJ |
ImageJ |
|
|
| Software, algorithm |
MACS 2.1.2 |
Zhang et al., 2008 |
|
|
| Software, algorithm |
MEME suite 5.1.1 |
Bailey et al., 2009 |
|
|
| Software, algorithm |
RStudio 3.4.1 |
https://www.rstudio.com |
|
|
| Software, algorithm |
Samtools 1.9 |
Li et al., 2009 |
|
|
| Software, algorithm |
Subread 1.6.3 |
Liao et al., 2014 |
|
|
| Software, algorithm |
Trim Galore! 0.5.0 |
http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ |
|
|
| Software, algorithm |
Trimmomatic 0.39 |
Bolger et al., 2014 |
|
|
| Other |
Dynabeads Protein G |
ThermoFisher |
10004D |
|
| Other |
Dynabeads M280 sheep anti-mouse IgG |
ThermoFisher |
11202D |
|
| Other |
SuperScript III Reverse Transcriptase |
ThermoFisher |
18080085
|
|
