Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Mouse: C57BL/6J (CD45.2 and CD45.1) | Jackson Laboratory | RRID: IMSR_JAX:000664 | |
| Genetic reagent (M. musculus) | Mouse: B6. Cg-Tg(Cd4-cre)1Cwi/BfluJ (Cd4-Cre) | Jackson Laboratory | RRID: IMSR_JAX:022071 | |
| Genetic reagent (M. musculus) | Mouse: B6. Cg-Ndor1Tg(UBC-cre/ERT2)1Ejb/2J (Rosa26CreER) | Jackson Laboratory | RRID: IMSR_JAX:008085 | |
| Genetic reagent (M. musculus) | Mouse: B6. SMARTA | R. Ahmed | Emory University | |
| Genetic reagent (M. musculus) | Mouse: B6. Pdk1fl/fl | W. Yuan | Chinese Academy of Medical Sciences and Peking Union Medical College | |
| Cell line (H. sapiens) | HEK293T (human embryonic kidney cells) |
ATCC | Cat # CRL-3216, RRID: CVCL_0063 | |
| Biological sample (M. musculus) | Primary mouse splenocytes | China Agricultural University | Freshly isolated from mice | |
| Biological sample (M. musculus) | Primary mouse bone marrow cells | China Agricultural University | Freshly isolated from mice | |
| Biological sample (M. musculus) | Primary mouse serum | China Agricultural University | Freshly isolated from mice | |
| Antibody | Rat monoclonal anti-mouse CD19-PE/Cy7 | Thermo Fisher Scientific | Cat # 25-0193-82, RRID: AB_657663 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD25-PE | Thermo Fisher Scientific | Cat # 12-0251-83; RRID: AB_465608 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD4-PE/Cy7 | Thermo Fisher Scientific | Cat # 25-0041-82; RRID: AB_469576 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD4-APC/eFluor 780 | Thermo Fisher Scientific | Cat # 47-0041-82; RRID: AB_11218896 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD4-BV510 | BD Biosciences | Cat # 563106; RRID: AB_2687550 | IF (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD44-FITC | Thermo Fisher Scientific | Cat # 11-0441-82; RRID: AB_465045 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD44-APC | Thermo Fisher Scientific | Cat # 17-0441-83; RRID: AB_469391 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD45.1-APC | Thermo Fisher Scientific | Cat # 17-0453-82; RRID: AB_469398 | FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse CD45.1- Percp/Cy5.5 | Thermo Fisher Scientific | Cat # 45-0453-82; RRID: AB_1107003 | FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse CD45.2- APC | Thermo Fisher Scientific | Cat # 17-0454-82; RRID: AB_469400 | FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse CD45.2- eFluor 506 | Thermo Fisher Scientific | Cat # 69-0454-82 RRID: AB_2637105 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD62L- BV510 | BioLegend | Cat # 104441; RRID: AB_2561537 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD62L- APC | Thermo Fisher Scientific | Cat # 17-0621-83; RRID: AB_469411 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD45R-FITC | Thermo Fisher Scientific | Cat # 11-0452-86; RRID: AB_465056 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD45R- PerCP/Cy5.5 | Thermo Fisher Scientific | Cat # 45-0451-82; RRID: AB_1107002 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human CD45R- Biotin | Thermo Fisher Scientific | Cat # 13-0452-86; RRID: AB_466451 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IgD- APC | Thermo Fisher Scientific | Cat # 17-5993-82; RRID: AB_10598660 | IF (1:100) |
| Antibody | Rat monoclonal anti-mouse/human GL7- eFluor 450 | Thermo Fisher Scientific | Cat # 48-5902-82; RRID: AB_10870775 | FACS (1:100) |
| Antibody | Armenian hamster monoclonal anti-mouse PD-1- PE | Thermo Fisher Scientific | Cat # 12-9985-82; RRID: AB_466295 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse TCR Vα2-PE | Thermo Fisher Scientific | Cat # 12-5812-82; RRID: AB_465949 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/rat Foxp3-PerCP/Cy5.5 | Thermo Fisher Scientific | Cat # 45-5773-82 ; RRID: AB_914351 |
FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/rat Foxp3-APC | Thermo Fisher Scientific | Cat # 17-5773-82 ; RRID: AB_469457 |
FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD138-PE | BD Biosciences | Cat # 553714; RRID: AB_395000 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse CD138-BV421 | BD Biosciences | Cat # 562610; RRID: AB_11153126 | FACS (1:100) |
| Antibody | Armenian hamster monoclonal anti-mouse Fas-PE | BD Biosciences | Cat # 561985; RRID: AB_10895586 |
FACS (1:100) |
| Antibody | Mouse monoclonal anti-mouse/human Bcl6-PE | BD Biosciences | Cat # 561522; RRID: AB_10717126 | FACS (1:40) |
| Antibody | Rat monoclonal anti-mouse SLAM-PE | BioLegend | Cat # 115904; RRID: AB_10895586 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse SLAM-APC | BioLegend | Cat # 115910; RRID: AB_493460 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse/human ICOS-PE/Cy7 | BioLegend | Cat # 313520; RRID: AB_10643411 | FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IFN-γ-FITC | Thermo Fisher Scientific | Cat # 11-7311-82; RRID: AB_465412 |
FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IL-17a-PE | BD Biosciences | Cat # 559502; RRID: AB_397256 |
FACS (1:100) |
| Antibody | Rat monoclonal anti-mouse IL-4-PE/Cy7 | Thermo Fisher Scientific | Cat # 25-7041-80; RRID: AB_2573519 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/human TCF1 | Cell Signaling Technology | Cat # 2203; RRID: AB_2199302 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human PDK1 | Cell Signaling Technology | Cat # 3062; RRID: AB_2236832 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/human Hif1a | Cell Signaling Technology | Cat # 36169; RRID: AB_2799095 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human FoxO1 | Cell Signaling Technology | Cat # 2880; RRID: AB_2106495 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-AKTT308 | Cell Signaling Technology | Cat # 13038; RRID: AB_2629447 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-AKTS473 | Cell Signaling Technology | Cat # 4060; RRID: AB_2315049 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-S6S235/236 | Cell Signaling Technology | Cat # 4858; RRID: AB_916156 |
FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human p-FoxO1/3a | Cell Signaling Technology | Cat # 9464; RRID: AB_329842 |
FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human p-PKCζ/λ | Cell Signaling Technology | Cat # 9378; RRID: AB_2168217 |
FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human AKT | Beyotime Biotechnology | Cat # AA326 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/human GSK3β | Beyotime Biotechnology | Cat # AF1543 | FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human p-GSK3βS9 | Cell Signaling Technology | Cat # 5558 RRID: AB_10013750 |
FACS (1:100) |
| Antibody | Rabbit polyclone anti-mouse/rat/human p-STAT3S727 | Cell Signaling Technology | Cat # 9134 RRID: AB_331589 |
FACS (1:100) |
| Antibody | Rabbit monoclonal anti-mouse/rat/human STAT3 | Cell Signaling Technology | Cat # 4904 RRID: AB_331269 |
FACS (1:100) |
| Antibody | Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-FITC | BioLegend | Cat # 406403; RRID: AB_893531 |
FACS (1:1000) |
| Antibody | Donkey polyclonal anti-rabbit IgG (minimal x-reactivity)-AF647 | BioLegend | Cat # 406414; RRID: AB_2563202 |
FACS (1:1000) |
| Transfected construct (M. musculus) | MIGR1 (MSCV-IRES-GFP) (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-Tcf7 overexpressing (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-Bcl6 overexpressing (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-STAT3-CA (constitutive-active) (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Transfected construct (M. musculus) | MIGR1-Cxcr5 overexpressing (plasmid) | This paper | N/A | Retrovirus construct to transfect |
| Sequence-based reagent | Tcf7_F | This paper | PCR primers | CCCTTCCTGCGGATATAGAC |
| Sequence-based reagent | Tcf7_R | This paper | PCR primers | GGTACACCAGATCCCAGCAT |
| Sequence-based reagent | Cxcr5_F | This paper | PCR primers | CATGGGCTCCATCACATACA |
| Sequence-based reagent | Cxcr5_R | This paper | PCR primers | GGCATGAATACCGCCTTAAA |
| Sequence-based reagent | Bcl6_F | This paper | PCR primers | AGACGCACAGTGACAAACCA |
| Sequence-based reagent | Bcl6_R | This paper | PCR primers | AGTGTGGGTCTTCAGGTTGG |
| Sequence-based reagent | Icos_F | This paper | PCR primers | TGCCGTGTCTTTGTCTTCTG |
| Sequence-based reagent | Icos_R | This paper | PCR primers | CTTCCCTTGGTCTTGGTGAG |
| Sequence-based reagent | Pdcd1_F | This paper | PCR primers | CTGGTCATTCACTTGGGCTG |
| Sequence-based reagent | Pdcd1_R | This paper | PCR primers | AAACCATTACAGAAGGCGGC |
| Sequence-based reagent | Maf_F | This paper | PCR primers | AGCAGTTGGTGACCATGTCG |
| Sequence-based reagent | Maf_R | This paper | PCR primers | TGGAGATCTCCTGCTTGAGG |
| Sequence-based reagent | Hif1a_F | This paper | PCR primers | CCTTAACCTGTCTGCCACTTTG |
| Sequence-based reagent | Hif1a_R | This paper | PCR primers | TCAGCTGTGGTAATCCACTCTC |
| Sequence-based reagent | Gzmb_F | This paper | PCR primers | CAAAGACCAAACGTGCTTCC |
| Sequence-based reagent | Gzmb_R | This paper | PCR primers | CTCAGCTCTAGGGACGATGG |
| Sequence-based reagent | Id2_F | This paper | PCR primers | GTCCTTGCAGGCATCTGAAT |
| Sequence-based reagent | Id2_R | This paper | PCR primers | TTCAACGTGTTCTCCTGGTG |
| Sequence-based reagent | Prdm1_F | This paper | PCR primers | ACAGAGGCCGAGTTTGAAGAGA |
| Sequence-based reagent | Prdm1_R | This paper | PCR primers | AAGGATGCCTCGGCTTGAA |
| Sequence-based reagent | Gata3_F | This paper | PCR primers | CTTATCAAGCCCAAGCGAAG |
| Sequence-based reagent | Gata3_R | This paper | PCR primers | CATTAGCGTTCCTCCTCCAG |
| Sequence-based reagent | Stat3_F | This paper | PCR primers | CAATACCATTGACCTGCCGAT |
| Sequence-based reagent | Stat3_R | This paper | PCR primers | GAGCGACTCAAACTGCCCT |
| Peptide, recombinant protein | KLH | Sigma–Aldrich | Cat# H7017 | |
| Peptide, recombinant protein | GP61-80 (GLNGPDIYKGVYQFKSVEFD) | Synthesized by ChinaPeptides | N/A | |
| Peptide, recombinant protein | recombinant murine IL-2 | R and D | Cat # 212–12 | |
| Peptide, recombinant protein | recombinant murine IL-7 | R and D | Cat # 217–17 | |
| Commercial assay or kit | Phosflow Lyse/Fix buffer, 5X | BD Biosciences | Cat # 558049; RRID: AB_2869117 |
|
| Commercial assay or kit | Phosflow Perm buffer I | BD Biosciences | Cat # 557885 RRID: AB_2869104 |
|
| Commercial assay or kit | Caspase-3 Staining Kit | Thermo Fisher Scientific | Cat # 88-7004-42; RRID: AB_2574939 | |
| Commercial assay or kit | Fixation/Permeabilization Solution Kit | BD Biosciences | Cat # 554714 RRID: AB_2869008 |
|
| Commercial assay or kit | Dynabeads M-280 Streptavidin | Thermo Fisher Scientific | Cat # 60210 | |
| Commercial assay or kit | Lipofectamine 2000 Reagent | Thermo Fisher Scientific | Cat # 11668019 | |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Cat # 74106 | |
| Commercial assay or kit | FastQuant RT Kit | Tiangen | Cat # KR106-02 | |
| Commercial assay or kit | SuperReal PreMix Plus SYBR Green | Tiangen | Cat # FP205-02 | |
| Chemical compound, drug | Freund’s Adjuvant, Complete | Sigma–Aldrich | Cat # F5881 | |
| Chemical compound, drug | Tamoxifen | Sigma–Aldrich | Cat # T5648 | |
| Chemical compound, drug | Corn Oil | Sigma–Aldrich | Cat # C8267 | |
| Chemical compound, drug | PMA | Sigma–Aldrich | Cat # P8139 | |
| Chemical compound, drug | Ionomycin | Sigma–Aldrich | Cat # I0634 | |
| Chemical compound, drug | Polybrene | Sigma–Aldrich | Cat # H9268 | |
| Software, algorithm | Flowjo v10.5 | Treestar | RRID: SCR_008520 | |
| Software, algorithm | Graphpad Prism 8 | Graphpad | RRID: SCR_002798 | |
| Software, algorithm | Adobe Illustrator | Adobe | RRID: SCR_010279 | |
| Software, algorithm | GSEA | http://www.broadinstitute.org/gsea/ | RRID: SCR_003199 | |
| Other | 7-AAD | BD Biosciences | Cat # 559925 RRID: AB_2869266 |
|
| Other | PNA-FITC | Vector Laboratories | Cat # FL-1071; RRID: AB_2315097 | FACS (1:500) |
| Other | PNA-Biotin | Vector Laboratories | Cat# BA-0074; RRID: AB_2336190 | IF (1:50) |
| Other | Streptavidin-APC/eFluor 780 | Thermo Fisher Scientific | Cat # 47-4317-82; RRID: AB_10366688 | FACS (1:500) |
| Other | Streptavidin-eFluor 450 | Thermo Fisher Scientific | Cat # 48-4317-82; RRID: AB_10359737 | FACS (1:500) |