REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
RPA-pSer33 | Bethyl | Cat#A300-246A, RRID:AB_2180847 |
RPA | Abcam | Cat#Ab2175, RRID:AB_302873 |
gH2AX | Millipore | Cat#05-636, RRID:AB_309864 |
ATM-pSer1981 | Millipore | Cat#05-740, RRID:AB_309954 |
ATM | Sigma Aldrich | Cat#A1106, RRID:AB_796190 |
Chk1 | Cell Signaling Technology | Cat#2360, RRID:AB_2080320 |
Chk1-pSer345 | Cell Signaling Technology | Cat#133D3, RRID:AB_331212 |
Chk2 | Millipore | Cat#05-649, RRID:AB_2244941 |
Cleaved Caspase 3 | Cell Signaling Technology | Cat#9661, RRID:AB_2341188 |
BRCA1 | Millipore | Cat#OP107, RRID:AB_213254 |
BRCA2 | Millipore | Cat#OP95, AB_206776 |
ALC1/CHD1L | Cell Signaling Technology | Cat#13460, RRID:AB_2798225 |
MBD4 | Invitrogen | Cat#PA5-51670, RRID:AB_2643787 |
SMUG1 | Abcam | Cat#ab192240 |
dUTPase/DUT | Abcam | Cat#ab137097 |
α-Tubulin | Sigma-Aldrich | Cat#T6199, RRID:AB_477583 |
UNG | Novus Biologicals | Cat#NBP1-49985, RRID:AB_10012175 |
PARP1 | Cell Signaling Technology | Cat#9542, RRID:AB_216073 |
UBC13/UBE2N | Cell Signaling Technology | Cat#4919, RRID:AB_2211168 |
PARP2 | Sigma-Aldrich | Cat#MABE18, RRID:AB_10807040 |
Histone H3 | Abcam | Cat#ab10799, RRID:AB_470239 |
53BP1 | Bethyl Laboratories | Cat#A300-272A, RRID:AB_185520 |
PAR binding reagent | Millipore | Cat#MBE1031 |
ALC1/CHD1L (mouse) | St John’s laboratory | Cat#STJ116477 |
53BP1 | Novus Biologicals | Cat#NB100-304, RRID:AB_10003037 |
RAD51 | Millipore | Cat#ABE257, RRID:AB_10850319 |
Beta-Actin (AC-15) | Sigma-Aldrich | Cat#A1978, RRID:AB_476692 |
BARD1 | Abcam | Cat#ab64164, RRID:AB_1924804 |
SMC1 antibody | Abcam | Cat# ab21583, RRID:AB_2192477 |
DAPI | Life Technology | Cat#D21490 |
Goat anti-Mouse Immunoglobulins/HRP | Agilent-Dako | Cat#P0447, RRID:AB_2617137 |
Swine anti-Rabbit Immunoglobulins/HRP | Agilent-Dako | Cat#P0399, RRID:AB_2617141 |
Bacterial and Virus Strains | ||
E. coli Rosetta (DE3) Competent Cells | Novagen(Merck) | Cat#0954-3CN |
One Shot ccdB Survival 2 T1R Competent Cells | ThermoFisher | Cat#A10460 |
One Shot Stbl3 Chemically Competent E. coli | ThermoFisher | Cat#C737303 |
Critical Commercial Assays | ||
CellTiter-Glo | Promega | Cat#G8462 |
Chemicals, Peptides, and Recombinant Proteins | ||
Doxycycline | Sigma-Aldrich | Cat#M0503-5X2MG |
Blasticidin | ThemoFisher Scientific | Cat#A1113903 |
Hygromycin B | ThemoFisher Scientific | Cat#10687010 |
Zeocin | ThemoFisher Scientific | Cat#R25005 |
Puromicin | ThemoFisher Scientific | Cat#A1113803 |
Lipofectamine 2000 | ThemoFisher Scientific | Cat#11668019 |
EDTA-free Complete protease inhibitor cocktail | Roche | Cat#COEDTAF-RO |
PhosSTOP phosphatase inhibitor cocktail | Roche | Cat#PHOSS-RO |
4x NuPAGE LDS sample buffer | ThemoFisher Scientific | Cat#NP0008 |
ProLong Gold antifade with DAPI | Thermo Fisher Scientific | Cat#P36931 |
Lipofectamine RNAiMAX | Invitrogen | Cat#13778150 |
QIAquick PCR purification kit | QIAGEN | Cat#28106 |
QIAquick Gel Extraction Kit | QIAGEN | Cat#28706 |
QIAprep Spin Miniprep Kit | QIAGEN | Cat# 27106 |
Veliparib | Selleck Chemicals | Cat#S1004 |
Olaparib | Selleck Chemicals | Cat#S1060 |
Talazoparib | Selleck Chemicals | Cat#S7048 |
Etoposide | Sigma Aldrich | Cat#BP885 |
Cisplatin | Sigma Aldrich | Cat#C2210000 |
Aphidicolin | Sigma Aldrich | Cat#A0781-1MG |
Hydroxyurea (HU) | Sigma Aldrich | Cat#H8627-5G |
Camptothecin | Sigma Aldrich | Cat#C9911 |
Methyl methanesulfonate (MMS) | Sigma Aldrich | Cat#129925-5G |
PARGi | Sigma Aldrich | Cat#PDD00017273 |
dU | Sigma Aldrich | Cat#D5412 |
5-FU | Sigma Aldrich | Cat#6627 |
Formy-dU | Gift from Stephen West | NA |
INDOLE-3-ACETIC ACID (IAA) | Sigma-Aldrich | Cat#I2886 |
Resazurin | Sigma-Aldrich | Cat#R7017 |
Doxycycline hyclate | Sigma-Aldrich | Cat#D9891 |
Subcellular Protein Fractionation Kit | Thermo Fisher | Cat# 78840 |
Clarity Western ECL | Bio-Rad | Cat#1705061 |
Clarity Max Western ECL | Bio-Rad | Cat#1705062 |
Mononucleosomes | EpiCypher | Cat No. 16-0006 |
Recombinant human PARG protein | Lambrecht et al., 2015 | N/A |
Recombinant human PARP1 protein | Gibbs-Seymour et al., 2016 | N/A |
Recombinant human ALC1 macro domain a.a 585-897 | This paper | N/A |
HiLoad 16/600 Superdex 200 pg | Sigma-Aldrich | GE28-9893-35 |
Benzonase Nuclease | Millipore-Merck | E1014 |
Ni-NTA Agarose | QIAGEN | 30230 |
QuikChange Lightning Site-Directed Mutagenesis Kit | Agilent | 210519 |
NAD+[32P] | Perkinelmer | NEG023X500UC |
IPTG | Sigma-Aldrich | I6758-5G |
Lysozyme | Sigma-Aldrich | 62971-10G-F |
Olaparib | Enzo Life Sciences | LKT-O4402-M005 |
Q5 Site-Directed Mutagenesis Kit | New England BioLabs | Cat#E0554 |
Diethylnitrosamine | Sigma-Aldrich | N0756 |
Deposited Data | ||
Code | GitHub | https://github.com/saphir746/ALC1-HR-survival |
Mendeley Data | Mendeley | https://doi.org/10.17632/xhw58f995c.1 |
Experimental Models: Cell Lines | ||
Mouse: ALC1 +/+ MEFs #18 | This Paper | N/A |
Mouse: ALC1 +/+ MEFs #19 | This Paper | N/A |
Mouse: ALC1 −/− MEFs #11 | This Paper | N/A |
Mouse: ALC1 −/− MEFs #14 | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 (Non-targeting gRNA LentiGuide Hygro) | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11(ALC1 EX2 gRNA LentiGuide Hygro) | This Paper | N/A |
Human: U2OS Flp-In T-Rex HOST | Durocher lab | N/A |
Human: ALC1 −/− U2OS Flp-In T-REx | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 Non-targeting gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 Non-targeting gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 PARP1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 PARP1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 PARP2 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 PARP2 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 53BP1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 53BP1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 pLenti CMV Puro (control) | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 pLenti CMV Puro (control) | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 pLenti CMV ALC1 CRISPR-resistant Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 pLenti CMV ALC1 G750E CRISPR-resistant Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 pLenti CMV ALC1 K77R CRISPR-resistant Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 Non-targeting gRNA LentiGuide Hygro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1 EX2 gRNA LentiGuide Hygro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 POLQ gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 POLQ gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 POLB gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 POLB gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 FEN1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 FEN1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 EXO1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 EXO1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 LIG4 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 LIG4 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 LIG1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 LIG1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 LIG3 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 LIG3 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 HPF1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 HPF1 gRNA LentiGuide Puro | This Paper | N/A |
Human: DLD-1 ALC1 NT LentiCRISPR Puro | This Paper | N/A |
Human: DLD-1 BRCA2−/− NT LentiCRISPR Puro | This Paper | N/A |
Human: DLD-1 ALC1 EX2 LentiCRISPR Puro | This Paper | N/A |
Human: DLD-1 BRCA2−/− ALC1 EX2 NT LentiCRISPR Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 UBC13 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 UBC13 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 ATM gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 ATM gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 DUT gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 DUT gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 SMUG1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 SMUG1 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 UNG gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 UNG gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 MBD4 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 MBD4 gRNA LentiGuide Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 pLenti CMV Puro (control) #2 | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 pLenti CMV ALC1 Puro | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 SMUG1 −/− | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 SMUG1 −/− | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1+/+ #1 APEX1 −/− | This Paper | N/A |
Human: eHAP iCAS9 #3 ALC1−/− #11 APEX1 −/− | This Paper | N/A |
Human: HCT116 BARD1AID/AID | Nakamura et al., 2019 | https://doi.org/10.1038/s41556-019-0282-9 |
Human: HCT116 53BP1−/− BARD1AID/AID | Becker et al., 2020 (bioRxiv) | https://doi.org/10.1101/2020.06.01.127951 |
Experimental Models: Organisms/Strains | ||
Mouse: Chd1lGt(E305F08)Wrst | This Paper | MGI:3910467 |
Oligonucleotides | ||
ALC1 G750E F: GGGCAGAGGTGAGTTATTTACAGCTC | This Paper | NA |
ALC1 G750E R: CAGTGGCCAGAGTCATCT | This Paper | NA |
ALC1 EX2 CRISPR-R F:ATTAGAAGGCGGAGT AAACTGGCTCGCC |
This Paper | NA |
ALC1 EX2 CRISPR-R R:TGATAGCTCCTTAG GTGAATCCCTGTCAGC |
This Paper | NA |
BRCA1 siGENOME smart-pool | Dharmacon | M-003461-02 |
BRCA2 siGENOME smart-pool | Dharmacon | M-003462-01 |
MPG ON-TARGETplus | Dharmacon | L-005146-00-0005 |
Non-targeting ON-TARGETplus | Dharmacon | D-001810-10 |
ALC1KO-3, TTTCTGCCAGGTGGATTAGG; ALC1KO-4, ATACCCTGCTTGCCATGAAA; ALC1KO-5, ATTCTGGCAATGGAAGCACT | This paper | N/A |
CRISPR Guides | This Paper | Table S1 |
Sequencing Barcodes | This Paper | Table S2 |
Recombinant DNA | ||
pLenti CMV Puro DEST (w118-1) | Addgene | #17452 |
ALC1 CRISPR-R CMV Puro DEST | This Paper | NA |
ALC1 G750E CRISPR-R CMV Puro DEST | This Paper | NA |
ALC1 K77R CRISPR-R CMV Puro DEST | This Paper | NA |
ALC1wt CMV Puro DEST | This Paper | NA |
BFP/GFP Cas9 reporter | Addgene | #67980 |
px459v2 | Addgene | #62988 |
LentiCRISPRv2 | Addgene | #52961 |
Lenti-sgRNA-Hygro | Addgene | #104991 |
Lenti-sgRNA-Puro | Addgene | #104990 |
pX458 | Addgene | #48138 |
Edit-R inducible lentiviral Cas9 | Horizon Discovery | #CAS11229 |
CRISPR Guides | This Paper | Table S1 |
pNIC-CTHF-ALC1 585-897 | This paper | N/A |
pNIC-CTHF-ALC1 585-897(D723A) | This paper | N/A |
Software and Algorithms | ||
Fiji | NIH | https://imagej.net/Fiji/Downloads |
Image Lab 5.2.1 | Bio-Rad Laboratories | http://www.bio-rad.com/en-uk/product/image-lab- software?ID = KRE6P5E8Z |
Adobe Illustrator 23.11 | Adobe | https://www.adobe.com/uk/products/illustrator.html |
Adobe Photoshop 20.0.08 | Adobe | https://www.adobe.com/uk/products/photoshop.html |
Prism 8 | GraphPad Software | https://www.graphpad.com/ |
BWA | Li and Durbin, 2009 | 0.5.9-r16 |
MAGeck | Li et al., 2014 | 0.5.7 |
R | https://www.r-project.org | 3.6.3 (2020-02-29) “Holding the Windsock” |
QuPath-0.2.3 | https://doi.org/10.1038/s41598-017-17204-5 | https://qupath.github.io/ |
Other | ||
High fat diet | Teklad | TD.06414 |
Uncropped Data | Mendeley | https://data.mendeley.com/datasets/xhw58f995c/draft?a=f322441d-e12e-4a47-b15b-95d388b35ea1 |