KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| APE1 | abcam | Cat#ab194; RRID:AB_302694 |
| BAF | abcam | Cat#ab129184; RRID:AB_11150422 |
| BrdU | Millipore | Cat#MAB3510; RRID:AB_94897 |
| Calreticulin | Invitrogen | Cat#PA3-900; RRID:AB_325990 |
| cGAS | Cell signaling technology | Cat#15102; RRID:AB_2732795 |
| CHMP2A | ProteinTech | Cat#10477-1-AP; RRID:AB_2079470 |
| dsDNA | Abcam | Cat#ab27156; AB_470907 |
| GFP | Santa Cruz | Cat#sc-9996; RRID:AB_627695 |
| GFP | Invitrogen | Cat#A-11120; AB_221568 |
| H3K9ac | Cell signaling technology | Cat#9649; RRID:AB_823528 |
| Histone H2A | Abcam | Cat#ab18255; RRID:AB_470265 |
| LaminB1 | Abcam | Cat#ab16048; RRID:AB_443298 |
| LSD1 | Cell signaling technology | Cat#2184; RRID:AB_2070132 |
| mCherry | Abcam | Cat#ab213511; RRID:AB_2814891 |
| pIRF3 (S386) | Abcam | Cat#ab76493; RRID:AB_152383 |
| IRF3 (pS396) | Cell signaling technology | Cat#29047; RRID:AB_2773013 |
| pRPA32 (pT21) | Abcam | Cat#ab109394; RRID:AB_10860648 |
| Rb | BD | Cat#554136; RRID:AB_395259 |
| RPA32 | Abcam | Cat#ab2175; RRID:AB_302873 |
| SMC1 | Bethyl laboratories | Cat#A300-055A; RRID:AB_2192467 |
| TREX1 | Abcam | Cat#ab185228 |
| TREX1 | Santa Cruz | Cat#sc-271870; RRID:AB_10708266 |
| TRF2 (Rb. #647) | de Lange Lab | N/A |
| γH2AX | Millipore | Cat#056361 |
| α-tubulin | Abcam | Cat#ab7291; RRID:AB_2241126 |
| β-actin (m) | Abcam | Cat#ab8224; RRID:AB_449644 |
| β-actin (rb) | Abcam | Cat#ab8227; RRID:AB_2305186 |
| γ-tubulin | Abcam | Cat#ab11316; RRID:AB_297920 |
| Goat anti-Mouse IgG Alexa Fluor 488 | Invitrogen | Cat#A11001; RRID:AB_2534069 |
| Goat anti-Rabbit IgG Alexa Fluor 488 | Invitrogen | Cat#A11034; RRID:AB_2576217 |
| Goat anti-Mouse IgG Alexa Fluor Plus 555 | Invitrogen | Cat#A32727; RRID:AB_2633276 |
| Goat anti-Rabbit IgG Alexa Fluor Plus 555 | Invitrogen | Cat#A32732; RRID:AB_2633281 |
| Goat anti-Mouse IgG Alexa Fluor 647 | Invitrogen | Cat#A21236; RRID:AB_2535805 |
| Goat anti-Rabbit IgG Alexa Fluor 647 | Invitrogen | Cat#A21245; RRID:AB_2535813 |
| Goat anti-Mouse IgG HRP | Thermo Fisher Scientific | Cat#31432; RRID:AB_228302 |
| Donkey anti-rabbit IgG HRP | SouthernBiotech | Cat#6441-05; RRID:AB_2796374 |
| Goat anti-Mouse IgG Alexa Fluor Plus 680 | Invitrogen | Cat#A32729; RRID:AB_2633278 |
| Goat anti-Rabbit IgG Alexa Fluor Plus 800 | Invitrogen | Cat#A32735; RRID:AB_2633284 |
| Bacterial and Virus Strains | ||
| Biological Samples | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| Aqua Hold Pap Pen 2 | Thermo Fisher Scientific | Cat#23-769-533 |
| Cholera Toxin | Sigma-Aldrich | Cat#C8052-2mg |
| Cytochalasin B | Cayman Chemical Company | Cat#11328 |
| Cytofunnel | Shandon | Cat#5991039 |
| Dynabeads MyOne Streptavidin T1 | invitrogen | Cat#65601 |
| Dynabeads Protein G | invitrogen | Cat#10030 |
| ER tracker | Thermo Fisher Scientific | Cat#E34250 |
| Fugene HD Transfection Reagent | Promega | Cat#E2311 |
| Glass bottom dishes | Cellvis | Cat#D35-20-1.5-N |
| Glass bottom dishes (4 chamber) | Cellvis | Cat#D35C4-20-1.5-N |
| Horse Serum | Thermo Fisher Scientific | Cat#26050088 |
| human EGF | Sigma-Aldrich | Cat#E9644-.2mg |
| Hydroxyurea (HU) | Sigma-Aldrich | Cat#H8627-5G |
| Insulin | Sigma-Aldrich | Cat#I9278-5ml |
| ISD (Interferon Stimulatory DNA) | Invivogen | Cat#NC0432595 |
| Lipofectamine 3000 | Thermo Fisher Scientific | Cat#L3000075 |
| Ministrainer 40 μm | pluriSelect | Cat#43-10040-46 |
| Nitrocellulose membrane | Thermo Fisher Scientific | Cat#10600002 |
| Novex WedgeWell Tris Glycine Mini gels | Thermo Fisher Scientific | Cat#XP08160BOX |
| Odyssey Blocking Buffer (TBS) | LI-COR Biosciences | Cat#927-50000 |
| ProLong Gold antifade reagent | Invitrogen | Cat#P36934 |
| Protease Inhibitor Tablets, EDTA-free | Thermo Scientific | Cat#A32965 |
| Quick-RNA Miniprep Kit | Zymo | Cat#R1054 |
| Reversine | Cayman Chemical Company | Cat#10004412 |
| SYBR Green Master Mix | Applied Biosystems | Cat#A25742 |
| Spermidine | Thermo Fisher Scientific | Cat#AC132740010 |
| Spermine | Thermo Fisher Scientific | Cat#AC132750010 |
| SuperScript IV First-Strand Synthesis System | Invitrogen | Cat#18091200 |
| Critical Commercial Assays | ||
| 2'3'-Cyclic GAMP Direct EIA Kit | Arbor Assays | Cat#K067-H5 |
| BCA Protein Assay | Thermo Fisher Scientific | Cat#23227 |
| nCounter Human Inflammation V2 Panel | NanoString Technologies | Cat#XT-CSO-HIN2-12 |
| custom nCounter gene expression code set, see Table S1 | NanoString Technologies | N/A |
| Deposited Data | ||
| Raw Western blot, imaging and gene analysis data | this paper; Mendeley Data | http://dx.doi.org/10.17632/d8p53cv3ry.1 |
| Experimental Models: Cell Lines | ||
| BT474 | Michael Stratton Lab; Petljak et al., 2019 | N/A |
| BT549 | Hironori Funabiki Lab; Zierhut et al., 2019 | N/A |
| CAL-51 | Hironori Funabiki Lab; Zierhut et al., 2019 | N/A |
| HCC1143 | Hironori Funabiki Lab; Zierhut et al., 2019 | N/A |
| HEK293T | ATCC | Cat#ACS-4500 |
| HEK293T H2B-mCherry #4 | this paper | cET1 |
| HEK293T H2B-mCherry #4 GFP-cGAS #1 | this paper | cET2 |
| HEK293T H2B-mCherry #4 GFP-cGAS #1 3×FLAG-TREX1 #1 | this paper | cET3 |
| HEK293T GFP-cGAS 3xmCherry-NLS | this paper | cET4 |
| HeLa | ATCC | Cat#CRM-CCL-2 |
| HeLa (iCAS9) GFP-TREX1 NLS-3xmTurq | this paper | cPvM1 |
| HeLa (iCAS9) GFP-TREX1 NLS-3xmTurq RFP-KDEL | this paper | cPvM2 |
| HT1080 | ATCC | Cat#CCL-121 |
| HT1080 TREX1 KO | this paper | cJM1 |
| M2p1 (MCF10A TP53−/− doxi::TRF2-DN) | this paper | cLM1 |
| M2p1 H2B-mCherry GFP-cGAS | this paper | cJM2 |
| M2p1 H2B-mCherry GFP-BAF | this paper | cJM3 |
| M2p1 H2B-mCherry GFP-LaminB1 | this paper | cJM4 |
| M2p1 H2B-mCherry GFP-TREX1 | this paper | cJM5 |
| M2p1 TREX1 KO #1 | this paper | cLM2 |
| M2p1 TREX1 KO #1 H2B-mCherry GFP-cGAS | this paper | cJM6 |
| M2p1 TREX1 KO #1 H2B-mCherry GFP-BAF | this paper | cJM7 |
| M2p1 TREX1 KO #2 | this paper | cLM3 |
| M2p1 TREX1 KO #2 H2B-mCherry GFP-cGAS | this paper | cJM8 |
| M2p1 TREX1 KO #2 H2B-mCherry GFP-BAF | this paper | cJM9 |
| M2p1 TREX1 KO #2 H2B-mCherry GFP-LaminB1 | this paper | cJM10 |
| M2p1 TREX1 KO CGAS KO | this paper | cLM4 |
| MCF10A | Maria Jasin lab | N/A |
| MCF10A H2B-mCherry | this paper | cJM11 |
| MCF10A H2B-mCherry GFP-RPA70 NLS-3xmTurq | this paper | cJM12 |
| MCF10A Turq-3× FLAG-TREX1 | this paper | cLM5 |
| MCF10A Turq-3× FLAG-TREX1-D18N | this paper | cLM6 |
| MCF10A GFP-cGAS | this paper | cJM13 |
| MCF10A TREX1 KO #1 | this paper | cJM14 |
| MCF10A TREX1 KO #1 H2B-mCherry | this paper | cJM15 |
| MCF10A TREX1 KO #1 H2B-mCherry GFP-TREX1 | this paper | cJM16 |
| MCF10A TREX1 KO #1 H2B-mCherry GFP-TREX1 NLS-3xmTurq | this paper | cJM17 |
| MCF10A TREX1 KO #1 H2B-mCherry GFP-TREX1 cGAS-mTurqoise2 | this paper | cJM18 |
| MCF10A TREX1 KO #1 GFP-TREX1 | this paper | cLM7 |
| MCF10A TREX1 KO #1 GFP-TREX1 H2B-iRFP670 | this paper | cLM8 |
| MCF10A TREX1 KO #1 GFP-TREX1 H2B-iRFP670 NLS-3xmTurq | this paper | cPvM3 |
| MCF10A TREX1 KO #1 GFP-TREX1 H2B-iRFP670 NLS-3xmTurq RFP-KDEL | this paper | cPvM4 |
| MCF10A TREX1 KO #1 GFP-TREX1-ΔC (aa1-235) | this paper | cLM9 |
| MCF10A TREX1 KO #1 GFP-TREX1-ΔC H2B-iRFP670 | this paper | cLM10 |
| MCF10A TREX1 KO #1 GFP-TREX1-ΔC-SEC61-TMD | this paper | cLM11 |
| MCF10A TREX1 KO #1 GFP-TREX1-D18N | this paper | cLM12 |
| MCF10A TREX1 KO #1 GFP-TREX1-R128A R174 | this paper | cLM13 |
| MCF10A TREX1 KO #1 GFP-TREX1-ΔN (aa236-314) | this paper | cLM14 |
| MCF10A TREX1 KO #1 GFP-TREX1-309* | this paper | cLM15 |
| MCF10A TREX1 KO #1 GFP-TREX1-V235fs | this paper | cLM16 |
| MCF10A TREX1 KO #1 GFP-TREX1-D272fs | this paper | cLM17 |
| MCF10A TREX1 KO #1 GFP-TREX1-L287fs | this paper | cLM18 |
| MCF10A TREX1 KO #1 GFP-TREX1-P290L | this paper | cLM19 |
| MCF10A TREX1 KO #1 GFP-TREX1-Y305C | this paper | cLM20 |
| MCF10A TREX1 KO #1 GFP-TREX1-G306A | this paper | cLM21 |
| MCF10A TREX1 KO #1 Turq-3× FLAG-TREX1 | this paper | cLM22 |
| MCF10A TREX1 KO #1 Turq-3× FLAG-TREX1-D18N | this paper | cLM23 |
| MCF10A TREX1 KO #1 GFP-cGAS | this paper | cJM19 |
| MCF10A TREX1 KO #2 | this paper | cJM20 |
| MCF10A TREX1 KO #2 H2B-mCherry | this paper | cJM21 |
| MCF10A TREX1 KO #2 GFP-cGAS | this paper | cJM22 |
| MCF10A TREX1 hypomorph | this paper | cJM23 |
| MCF10A TREX1 KO #1 MB21D1 (cGAS) KO | this paper | cLM24 |
| MDA-MB-453 | Michael Stratton lab; Petljak et al., 2019 | N/A |
| Phoenix | Titia de Lange lab | N/A |
| RPE1 hTERT | ATCC | Cat#CRL-4000 |
| RPE1 hTERT TREX1 KO | this paper | cJM24 |
| T2p1 (RPE1 hTERT TP53−/− doxi::TRF2-DN) | Titia de Lange lab | N/A |
| T2p1 APEX1 KO | Titia de Lange lab | N/A |
| U2OS | ATCC | Cat#HTB-96 |
| Experimental Models: Organisms/Strains | ||
| Oligonucleotides | ||
| ISD (biotinylated or naked for pulldown experiments); (TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA) | IDT | N/A |
| IFNβ F for qPCR (AAACTCATGAGCAGTCTGCA) | Carr et al., 2017 | N/A |
| IFNβ R for qPCR (AGGAGATCTTCAGTTTCGGAGG) | Carr et al., 2017 | N/A |
| ISG56 F for qPCR (AAGGCAGGCTGTCCGCTTA) | Diner et al., 2015 | N/A |
| ISG56 R for qPCR (TCCTGTCCTTCATCCTGAAGCT) | Diner et al., 2015 | N/A |
| actin F for qPCR (CAACCGCGAGAAGATGAC) | Bakhoum et al., 2018 | N/A |
| actin R for qPCR (ATCACGATGCCAGTGGTACG) | Bakhoum et al., 2018 | N/A |
| hTREX1; guide RNA #1 (TCAACGCTTCGATGACAACC) | this paper | N/A |
| hTREX1; guide RNA #2 (GCATCTACACCCGCCTGTAC) | this paper | N/A |
| hTREX1; guide RNA #3 (CCACTGGAACAACCAACCTA) | this paper | N/A |
| hCGAS; guide RNA #2 (GGCCCCCATTCTCGTACGGA) | this paper | N/A |
| hCGAS; guide RNA #3 (GTTCGGCCCCGCCAGGAAGT) | this paper | N/A |
| TP53; guide RNA (GGCAGCTACGGTTTCCGTC) | this paper | N/A |
| Recombinant DNA | ||
| pTK puro HA-GFP-cGAS | gift from Zhijian Chen | N/A |
| pQCXIZ 3×FLAG-TREX1 | this paper | Addgene #164243 |
| pQCXIB H2B-mCherry | this paper | Addgene #164244 |
| pQCXIP GFP-TREX1 | this paper | Addgene #164245 |
| pQCXIP NLS-3×mTurquoise2 | this paper | Addgene #164246 |
| pLenti CMV GFP Neo | Campeau et al., 2009 | Addgene #17447 |
| pLenti CMV GFP Blast | Campeau et al., 2009 | Addgene #17445 |
| pLenti CMV GFP Puro | Campeau et al., 2009 | Addgene #17448 |
| pLenti 3xmCherry-NLS | gift from Emily Hatch | N/A |
| pLenti CMV GFP-TREX1 BLAST | this paper | Addgene #164228 |
| pLenti CMV GFP-TREX1-ΔC BLAST | this paper | Addgene #164229 |
| pLenti CMV GFP-TREX1-ΔC-SEC61-TMB BLAST | this paper | Addgene #164230 |
| pQCXIP GFP-RPA70 | this paper | Addgene #164231 |
| pQCXIZ Turq-3×FLAG-TREX1 | this paper | Addgene #164232 |
| pQCXIZ Turq-3×FLAG-TREX1 D18N | this paper | Addgene #164233 |
| pLenti CMV GFP-TREX1 D18N BLAST | this paper | Addgene #164225 |
| pLenti CMV GFP-TREX1 R128A R174 BLAST | this paper | Addgene #164234 |
| pLenti CMV GFP-TREX1 ΔN BLAST | this paper | Addgene #164235 |
| pLenti CMV GFP-TREX1 309* BLAST | this paper | Addgene #164242 |
| pLenti CMV GFP-TREX1 V235fs BLAST | this paper | Addgene #164236 |
| pLenti CMV GFP-TREX1D272fs BLAST | this paper | Addgene #164237 |
| pLenti CMV GFP-TREX1 L287fs BLAST | this paper | Addgene #164238 |
| pLenti CMV GFP-TREX1 P290L BLAST | this paper | Addgene #164239 |
| pLenti CMV GFP-TREX1 Y305C BLAST | this paper | Addgene #164240 |
| pLenti CMV GFP-TREX1 G306A BLAST | this paper | Addgene #164241 |
| pMaxGFP | Lonza | Cat#V4SC-9096 |
| pQCXIZ cGAS-mTurquoise2 | this paper | Addgene #164247 |
| pLentiPGK DEST H2B-iRFP670 | Kudo et al., 2018 | Addgene #90237 |
| pQCXIP GFP-BAF | this paper | Addgene #164248 |
| pQCXIP GFP-LmnB1 | this paper | Addgene #164249 |
| pU6 TREX1-g1 Cas9-T2A-mCherry | this paper | Addgene #164250 |
| pU6 sgTREX1-g2 Cas9-T2A-mCherry | this paper | Addgene #164251 |
| pU6 sgTREX1-g3 Cas9-T2A-mCherry | this paper | Addgene #164252 |
| pU6 cGAS-g2 Cas9-T2A-mCherry | this paper | Addgene #164253 |
| pU6 cGAS-g3 Cas9-T2A-mCherry | this paper | Addgene #164254 |
| pU6 p53-gRNA Cas9-T2A-mCherry | this paper | Addgene #164256 |
| pHP138-FLAG-TRF2-ΔBΔM | this paper | Addgene #164255 |
| p2K7 bsd-UBI-tagRFP-KDEL | Nunes-Hasler et al., 2017 | Addgene #114179 |
| psPAX2 | gift from Didier Trono | Addgene #12260 |
| pMD2.G | gift from Didier Trono | Addgene #12259 |
| Software and Algorithms | ||
| Other | ||