KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Horse radish peroxidase-conjugated goat polyclonal anti-mouse IgG (H+L) Fab’ | MBL | Cat#330; RRID: N/A |
| Goat Anti-Mouse IgG, Human adsorbed - Alkaline Phosphatase | Southern Biotech | Cat#1030-04; RRID: AB_2794293 |
| Mouse monoclonal anti-V5 tag antibody [SV5-Pk1] | Abcam | Cat#ab27671; RRID: AB_471093 |
| Mouse monoclonal anti-S tag antibody [SBSTAGa] | Abcam | Cat#ab24838; RRID: AB_448427 |
| Mouse monoclonal anti-FLAG M2 antibody | Sigma-Aldrich | Cat#F1804; RRID: AB_262044 |
| DyLight550 Goat Anti-Mouse IgG (H+L) | Thermo Fisher Scientific | Cat#84540; RRID: AB_10942171 |
| Mouse IgG1 isotype control monoclonal antibody (MOPC-21) (DyLight 488 conjugate) | Enzo | Cat#ADI-SAB-600-488; RRID: N/A |
| Mouse IgG1 kappa monoclonal [MOPC-21] isotype control | Abcam | Cat#ab18443; RRID: AB_1107784 |
| Custom-made anti-FLAG tag monoclonal antibodies (FLAG-1, FLAG-2 and FLAG-3) | This paper | N/A |
| Custom-made anti-S tag monoclonal antibodies (S-1 and S-2) | This paper | N/A |
| Custom-made anti-V5 tag monoclonal antibodies (V5-1 to V5-6) | This paper | N/A |
| Custom-made anti-mPLS1 monoclonal antibodies (PLS-1 to PLS-65) | This paper | N/A |
| Custom-made anti-mESPN1 monoclonal antibodies (N534-1 to N534-90; 657X-1 to 657X-21) | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Sulfo-SANPH Crosslinker | ProteoChem | Cat#c1111-100mg |
| Hyclone Super-Low IgG FBS | GE Healthcare | Cat#SH30898.03 |
| Protein A Sepharose CL-4B beads | GE Healthcare | Cat#17096303 |
| EZ-Link NHS-PEG4-Biotin | Thermo Fisher Scientific | Cat#21330 |
| DyLight 488 Maleimide | Thermo Fisher Scientific | Cat#46602 |
| DyLight 550 Maleimide | Thermo Fisher Scientific | Cat#62290 |
| Papain from papaya latex | Sigma-Aldrich | Cat#P4762 |
| 1.0 μm Gold Microcarriers | Bio-Rad | Cat#1652263 |
| DYKDDDDK tag Peptide | APExBIO | Cat#A6002 |
| S tag Peptide | APExBIO | Cat#A6007 |
| V5 Epitope tag Peptide | APExBIO | Cat#A6005 |
| Custom-made Atto488-Lifeact | Sigma-Aldrich, (Kiuchi et al., 2015) | N/A |
| Custom-made Atto550-Lifeact | Sigma-Aldrich, (Kiuchi et al., 2015) | N/A |
| Protein A/G | ProSpec | Cat#pro-646 |
| HEK293F cell lysate containing FLAG-EGFP | This paper | N/A |
| HEK293F cell lysate containing S-EGFP | This paper | N/A |
| HEK293F cell lysate containing V5-EGFP | This paper | N/A |
| Recombinant mPLS1 | This paper | N/A |
| Recombinant mESPN1 | This paper | N/A |
| Recombinant EGFP-mPLS1 | This paper | N/A |
| Recombinant EGFP-fused N534 mESPN1 fragment | This paper | N/A |
| Recombinant EGFP-fused 657X mESPN1 fragment | This paper | N/A |
| Experimental models: cell lines | ||
| Xenopus laevis XTC cells | Watanabe and Mitchison, 2002 | N/A |
| HEK293 cells | ATCC | Cat#CRL-1573 |
| Expi293F cells | Thermo Fisher Scientific | Cat#A14635 |
| P3U1 mouse myeloma cells | RIKEN BRC | Cat#JCRB0708 |
| Custom-made Hybridomas for FLAG-tag | MBL | N/A |
| Custom-made Hybridomas for S-tag | Mediridge Co., Ltd. | N/A |
| Custom-made Hybridomas for V5-tag | Mediridge Co., Ltd. | N/A |
| Custom-made Hybridomas for mPLS1 | Mediridge Co., Ltd. | N/A |
| Custom-made Hybridomas for mESPN1 | Mediridge Co., Ltd. | N/A |
| Experimental models: organisms/strains | ||
| Mouse (Slc: ICR) | Japan SLC, Inc. | Charles River Laboratories, Inc (1965) |
| Mouse (C57BL/6J) | The Jackson Laboratory | Stock No. 000664 |
| Oligonucleotides | ||
| gactacaaagacgatgacgacaag (DYKDDDDK peptide; FLAG tag) | Sigma-Aldrich | N/A |
| aaagaaaccgctgctgctaaattcgaacgccagcacatggacagc (KETAAAKFERQHMDS peptide; S tag) | Sigma-Aldrich | N/A |
| ggcaaaccgattccgaacccgctgctgggcctggatagcacc (GKPIPNPLLGLDST peptide; V5 tag) | Sigma-Aldrich | N/A |
| Recombinant DNA | ||
| Mouse plastin1 cDNA | Dharmacon | NM_1033210.3 |
| Mouse espin1 cDNA | UNITECH, Inc. | NM_207687.2 |
| Mouse espin3a cDNA | James Bartles (Feinberg School of Medicine, Northwestern University) | AY587570.1 |
| Rat CAP-GLY domain containing linker protein 1 | Y. Mimori-Kiyosue (RIKEN, Japan) | NM_031745.2 |
| Human histone cluster 1 H2B family member b cDNA | Dharmacon | NM_021062.2 |
| delCMV-EGFP-C1 plasmid vector | Watanabe and Mitchison, 2002 | N/A |
| Software and algorithms | ||
| MetaMorph Microscopy Automation and Image Analysis Software | Molecular Devices | N/A |
| Micro-Manager | Edelstein et al., 2014 | N/A |
| ImageJ | Schneider et al., 2012 | N/A |
| Prism 8.0 | GraphPad Software, Inc. | N/A |
| Custom-made python scripts | https://github.com/takushim/tanitracer | N/A |
| Imaris | Oxford Instruments | N/A |
| Other | ||
| Custom-made 96-well glass bottom plates with a high-density amino group coating | Matsunami Glass Ind., Ltd. | N/A |
| UV illumination at 365 nm using a UV transilluminator | NIPPON Genetics | MUV21-365 |
| epMotion96 | Eppendorf | Cat#5069000004 |
| Octet RED96 System (BioLayer Interferometry; BLI) | Sartorius | N/A |
| Streptavidin (SA) Biosensors | Sartorius | Cat#18-5019 |
| Custom-made coverslips with a high-density amino group coating (No. 1 thickness, ø = 25 mm) | Matsunami Glass Ind., Ltd. | N/A |
| Helios Gene Gun System | Bio-Rad | Cat#1652431 |
| Custom-made cone-shaped beam splitter rotating at 12,000 rpm by a hollow shaft motor | Olympus (Adachi et al., 2007) | N/A |