Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in the experiments.
| Name | Sequence |
|---|---|
| Linc00963 forward (human) | 5’- AGGAGCAACAGCGAAGGT -3’ |
| Linc00963 reverse (mouse) | 5’- TCTGTGGTGCGTGTCTGC -3’ |
| β-actin forward | 5’- GGCGGCACCACCATGTACCCT -3’ |
| β-actin reverse | 5’- AGGGGCCGGACTCGTCATACT -3’ |
| TRIM24 forward | 5’-GCAGGTGAAGAAGGCTCGAT-3’ |
| TRIM24 reverse | 5’- CCCAGAATGATGAGCAAGCA-3’ |
| miR-655 forward | 5’-AATAGTGCCTAAAGTGCTGC-3’ |
| miR-655 reverse | 5’-AGACCCACCTCAATCATCCT-3’ |
| U6 forward | 5’-CTCGCTTCGGCAGCACA-3’ |
| U6 reverse | 5’-AACGCTTCACGAATTTGCGT-3’ |
