REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Mouse monoclonal anti-Neurofascin (extracellular domain) | NeuroMab/Antibodies Incorporated | Cat# 75–172; RRID: AB_2282826 |
Rabbit polyclonal anti-TRIM46 | Synaptic Systems | Cat. # 377 003; RRID: AB_2631232 |
Mouse monoclonal anti-GM130 | BD Bioscience | Cat. # 610823; RRID: AB_398142 |
Rabbit polyclonal anti-RTN4a (Nogo) | Novus Biologicals | Cat. # NB100-56681; RRID: AB_838641 |
Mouse monoclonal anti-ERK1/2 (p44/42 MAPK) | Cell Signaling | Cat. # 4696; RRID: AB_390780 |
Rabbit polyclona anti-phospho-ERK1/2 (phospho-Thr202/Tyr204) | Cell Signaling | Cat. # 9101; RRID: AB_331646 |
Mouse monoclonal anti-Rab6; Clone: 5B10 | Prof. Angelika Barnekow (Münster University) | N/A |
Rabbit polyclonal anti-myc | Santa Cruz | Cat. # SC-40; RRID: AB_2857941 |
Rabbit polyclonal anti-GFP | Abcam | Cat. # ab290; RRID: AB_303395 |
Goat Anti-Rabbit IgG Antibody, IRDye 800CW Conjugated | LI-COR Biosciences | Cat. # 827-08364; RRID: AB_10793856 |
Goat Anti-Mouse IgG Antibody, IRDye 680LT Conjugated | LI-COR Biosciences | Cat. # 827-11081; RRID: AB_10795015 |
anti-mouse Alexa647 | Thermo Fisher | Cat. # A21236; RRID: AB_2535805 |
anti-rabbit Alexa647 | Thermo Fisher | Cat. # A21245; RRID: AB_2535813 |
anti-mouse Alexa405 | Thermo Fisher | Cat. # A-31553; RRID: AB_221604 |
anti-mouse Alexa488 | Thermo Fisher | Cat. # A11029; RRID: AB_138404 |
anti-rabbit Alexa488 | Thermo Fisher | Cat. # A11034; RRID: AB_2576217 |
anti-mouse Alexa568 | Thermo Fisher | Cat. # A11031; RRID: AB_144696 |
anti-rabbit Alexa568 | Thermo Fisher | Cat. # A11036; RRID: AB_10563566 |
Chemicals, Peptides, and Recombinant Proteins | ||
Recombinant mouse Brain Derived Neurotrophic Factor (BDNF) | Sino Biological | 50240-MNAS |
Biotin | Sigma | B4639 |
Dynasore | Sigma | D7693 |
Rapalog (A/C Heterodimerizer) | Takara Bio | 635056 |
Lipofectamine 2000 | Thermo Fisher | 11668019 |
Surface-SNAP-Alexa-488 | NEB | S9129S |
Surface-SNAP-Alexa-546 | NEB | S9132S |
Surface-SNAP-Alexa-647 | NEB | S9136S |
SYLGARD 184 Silicone Elastomer Kit | Dow | N/A |
Experimental Models: Cell Lines | ||
Human embryonic kidney 239T (HEK293T) | ATCC | CRL-3216 |
Experimental Models: Organisms/Strains | ||
Rat (Wistar) | Janvier | N/A |
Oligonucleotides | ||
Rab27A (rat) shRNA targeting sequence: CCAGTGTACTGTACCAGTA | This study, based on (Arimura et al., 2009) | N/A |
Rab27B (rat) shRNA targeting sequence: CAACATTTCTTTACCGATA | This study, based on (Arimura et al., 2009) | N/A |
KIF1A (rat) shRNA targeting sequence: CGAATATGCTGACATCTTC | (Kevenaar et al., 2016) | N/A |
KIF5C (rat) shRNA targeting sequence: TGAGATCACTTGGACAAA | (Pan et al., 2019) | N/A |
Rab6A (rat) shRNA targeting sequence: CACCTATCAGGCAACAATT |
(Schlager et al., 2010) | N/A |
Rab6B (rat) shRNA targeting sequence: CACCTACCAGGCAACCATC | (Schlager et al., 2010) | N/A |
Rab6A mutagenesis primer Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC | This study | N/A |
Rab6A mutagenesis primer Q72L-Rev: GTCCCATAATTGCAATCGTAC | This study | N/A |
Rab6A mutagenesis primer T27N-Fw: GTTGGAAAGAACTCTTTGATC ACCAGATTCATGTATGACAG |
This study | N/A |
Rab6A mutagenesis primer T27N-Rev: GCTTTGCTCCCCCAGGAA | This study | N/A |
Recombinant DNA | ||
pGW1-CMV | (Hoogenraad et al., 2005) | N/A |
pSuper vector | (Schlager et al., 2010) | N/A |
pBio-GFP | Hoogenraad lab | N/A |
pBirA | Hoogenraad lab | N/A |
TrkB-GFP | Prof. Rosalind Segal (Harvard University) | N/A |
SNAP-myc-TrkB | This study | N/A |
RUSH-TrkB-GFP | This study | N/A |
RUSH-SNAP-TrkB | This study | N/A |
RUSH-mRFP-NPY | This study | N/A |
GFP-Rab6A | Hoogenraad lab | N/A |
mCherry-Rab6A | Hoogenraad lab | N/A |
mCherry-Rab6A-Q72L | This study | N/A |
mCherry-Rab6A-T27N | This study | N/A |
mRuby3-Rab3C | This study | N/A |
mRuby3-Rab27B | This study | N/A |
mRFP-Rab11A | Hoogenraad lab | N/A |
mRFP-Rab8A | Hoogenraad lab | N/A |
mRFP-KIF5Cmd_(aa 1-559)-FKBP | Hoogenraad lab | N/A |
FRB-myc-KIF5Atd_(aa 375-1032) | Hoogenraad lab | N/A |
FRB-myc-KIF5Btd_(aa 374-963) | Hoogenraad lab | N/A |
FRB-myc-KIF5Ctd_(aa 376-955) | Hoogenraad lab | N/A |
FRB-myc-KIF17td_(aa 376-1028) | Hoogenraad lab | N/A |
FRB-myc-KIF3Atd_(aa 386-702) | Hoogenraad lab | N/A |
FRB-myc-KIF1Atd_(aa 395-1698) | Hoogenraad lab | N/A |
FRB-myc-KIF1Bα_td_(aa 390-1153) | Hoogenraad lab | N/A |
FRB-myc-KIF1Bβ_td_(aa 390-1770) | Hoogenraad lab | N/A |
FRB-myc-KIF1Ctd_(aa 395-1103) | Hoogenraad lab | N/A |
FRB-myc-KIF13Atd_(aa 397-1770) | Hoogenraad lab | N/A |
FRB-myc-KIF21Atd_(aa 377-1661) | Hoogenraad lab | N/A |
FRB-myc-KIF21Btd_(aa 410-1624) | Hoogenraad lab | N/A |
Bio-KIF5Atd_(aa 375-1032) | This study | N/A |
Bio-KIF5Btd_(aa 374-963) | This study | N/A |
Bio-KIF5Ctd_(aa 376-955) | This study | N/A |
Bio-KIF17td_(aa 376-1028) | This study | N/A |
Bio-KIF3Atd_(aa 386-702) | This study | N/A |
Bio-KIF1Atd_(aa 395-1698) | This study | N/A |
Bio-KIF1Bβ_td_(aa 390-1770) | This study | N/A |
Bio-KIF1Ctd_(aa 395-1103) | This study | N/A |
Bio-KIF13Atd_(aa 397-1770) | This study | N/A |
Bio-KIF21Atd_(aa 377-1661) | This study | N/A |
Bio-KIF21Btd_(aa 410-1624) | This study | N/A |
Software and Algorithms | ||
Fiji/ImageJ | NIH | Imagej.net |
Kymoreslicewide | Dr. Eugene Kathrukha (Utrecht University) | https://github.com/ekatrukha/KymoResliceWide |
Prism 7.0 | Graphpad | https://www.graphpad.com/scientific-software/prism/ |
R-Software | R Project | https://www.r-project.org/ |
Other | ||
3-Compartment Microfluidic Device (MFC) mold | Prof. Frederic Saudou (Virlogeux et al., 2018) | N/A |