Table 1.
Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFER |
|---|---|---|
| Antibody | ||
| Mouse HIF-1α | BD | 610959 |
| Rabbit PKM2 | CellSignaling Technology | 4053 S |
| Rabbit PHD3 | Abcam | ab30782 |
| Mouse hnRNPK | Santa cruz | Sc53620 |
| Rabbit hnRNPF | Abcam | Ab50982 |
| Mouse JMJD5 | Abcam | Ab10639 |
| Rabbit Hydroxyproline | Abcam | Ab37067 |
| Rabbit LaminB1 | Cell Signaling Technology | 12255 S |
| Mouse MnSOD | BD | 611580 |
| Rabbit HIF-2α | Cell Signaling Technology | 59973 S |
| Rabbit H3K27me3 | Cell Signaling Technology | 9733 S |
| Flag | Abcam | Ab205606 |
| Mouse β-actin | abcam | Ab6276 |
| Rabbit PKM1 | proteintech | 15821-1-AP |
| Biotin-antibody | Invitrogen | 033700 |
| Alexa Fluor Goat anti-mouse 594 | Invitrogen | A11032 |
| Alexa Fluor Goat anti-mouse 555 | Invitrogen | A28180 |
| Digoxin-antibody | Abcam | Ab419 |
| Rabbit LDHA | Cell Signaling Technology | 3582 |
| Rabbit Ki67 | Abcam | Ab15580 |
| Rabbit GLUT1 | Abcam | Ab115730 |
| Bacterial and Virus Strains | ||
| One Shot Stbl3 | Invitrogen | C7373–03 |
| pLentiCRISPR v2 plasmid | 57 | 18011CZ |
| pGL3-luciferase reporter vector | Jeneray biotech | VQP0124 |
| PcDNA3.1 vector | Jeneray biotech | Addgene#69352 |
| DH5α competent cells | TAKARA | 9057 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Puromycin | Gibco | A11138–03 |
| 10X T4 Ligation Buffer | New England Biolabs | #B0202 |
| Pierce™ IP Lysis Buffer | Thermo Fisher Scientific | 87787 |
| Trizol | Invitrogen | 15596–026 |
| Dynabeads M-280 Streptavidin magnetic beads | Invitrogen | 11205D |
| recombinant myc-labeled PHD3 | Origene | TP310319 |
| His-labeled PKM2 | Origene | TP721212 |
| EZ-Magna ChIP A/G Recombinant protein | Merck Millipore | 17–10086 |
| NEBNext Ultra II Q5 Master Mix | New England Biolabs | M0544L |
| Colorimetric peptide assay | Invitrogen | 23275 |
| 16%Formaldehyde (w/v) | Thermo Fisher Scientific | 28908 |
| Pierce chip-grade protein A/G magenetics beads | Invitrogen | 26162 |
| Deoxynucleotide (dNTP) Solution Mix | New England Biolabs | N0447L |
| 10 MM Bio-16-UTP 1 TUBE EACH | Invitrogen | AM8452 |
| Recombinant RNasin® Ribonuclease Inhibitor | Promega | N2515 |
| Halt™ Protease Inhibitor Cocktail (100X) | Pierce | 87786 |
| Critical Commercial Assays | ||
| Superscript First-Strand cDNA Synthesis Kit | Invitrogen | 18080–051 |
| SYBR Premix Ex Taq II kit | TAKARA | DRR081A |
| DIG Luminescent Detection Kit for Nucleic Acids | Roche | 11363514910 |
| Cell fractionation assay PARISTM kit | Ambion | AM 1921 |
| SMARTer RACE 5’/3’ Kit | Clontech | 634860 |
| Magna RNA Immunoprecipitation Kit | Millipore | 17–700 |
| TranscriptAid T7 High Yield Transcription Kit | Ambion | AM1333 |
| MagnaChIP HiSens Chromatin IP Kit | Merck Millipore | 17–10461 |
| LightshiftTMChemiluminescent RNA EMSA kit | Thermo Fisher Scientific | 20158 |
| Glucose Uptake Colorimetric Assay Kit | Biovision | k676 |
| lactate Colorimetric/Fluorometric Assay kit | Biovision | k607 |
| XFglycolytic stress test kit | Agilent Technologies | 103020100 |
| Experimental Models: Cell Lines | ||
| Human: MDA-MB-231 | N/A | N/A |
| Human:MCF-7 | N/A | N/A |
| Human:76 N | N/A | N/A |
| Human:293 T | N/A | N/A |
| Human: T47D | N/A | N/A |
| Human:SK-BR3 | N/A | N/A |
| Human:BT549 | N/A | N/A |
| Human:MDA-MB-468 | N/A | N/A |
| Experimental Models | ||
| Balb/c nu/nu mouse (3–4 weeks old female) | Vitonlihua Laboratory Animal Center | 11400700211483 |
| Oligonucleotides | ||
| GampeRHIFAL LNA1 | Exiqon | CATTCTGGGACGGAGA |
| GampeRHIFAL LNA2 | Exiqon | GTAACATGGTGATAAT |
| GampeR HIF1α-1 LNA | Exiqon | TGGCAAGCATCCTGTA |
| GampeR Control LNA | Exiqon | AACACGTCTATACGC |
| LNA mRNA Detection Probe | Exiqon | ACGGAGTAATGTTGGGTAAGCT |
| beta-actin, hsa/mmu/rno, 5-dig labeled | Exiqon | E61201 |
| HIFAL and hnRNPF sgRNA (See Table S1for sequences) | Invitrogen | N/A |
| Sequences of siRNAs (See Table S1 for sequences) | Invitrogen | N/A |
| Primers for qRT-PCR (See Table S1 for sequences) | Invitrogen | N/A |
| Primers for ChIP assay (See Table S1 for sequences) | Invitrogen | N/A |
| Primers for 5’ and 3’RACE (See Table S1 for sequences) | Invitrogen | N/A |
| Deposited Data | ||
| ChIP-seq reads | http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | 55 |
| adapter sequences | http://hannonlab.cshl.edu/fastx_toolkit/index.html | 56 |
| Software and Algorithms | ||
| SPSS version 16.0 | Chicago, IL | N/A |
| LaserConfocal Scan soft Zen2012 | Carl Zeiss | N/A |
| TCGAbiolinks | http://bioconductor.org/packages/release/bioc/html/TCGAbiolinks.html | 61 |
| All spectra of modified peptides | http://prospector.ucsf.edu/prospector/cgi-bin/msform.cgi?form=msproduct | 62 |