Table 1 . The candidate miRNAs interactions.

The first column represents the mirBase ID of miRNAs. The three next columns contain information about target UCRs. The fifth column includes the UniProt ID of the most potent rival mRNA. The two next columns represent the free binding energy to target UCR and the most potent rival mRNA, respectively. The last column shows the efficiency score of the candidate miRNA.

miRNA	UCR sequence	UCR location	UCR region	rival mRNA ID	$E_{(\mathcal{M},\mathcal{U})}$	${\mathrm{m}\mathrm{i}\mathrm{n}}_{\mathcal{R}}\{E_{(\mathcal{M},\mathcal{R})}\}$	$S_{(\mathcal{M}\mathcal{,}\mathcal{U}\mathcal{)}}$
hsa-miR-374a-5p	UUACAAACAAUUUGAUACUU	19569–19588	ORF1ab, nsp11	ENSG00000186184	−15.27	−10.9	−4.37
hsa-miR-548b-3p	GAAGAGCAACCAAUG	27361–27375	ORF6	ENSG00000109572	−10.05	−6.1	−3.95
hsa-miR-1-3p	CACAUGCUUUUCCA	18681–18694	ORF1ab, nsp11	ENSG00000100485	−10.86	−8.4	−2.46
hsa-miR-224-5p	UUUACUCAACCGCUACUUUAGAC	11659–11681	ORF1ab, nsp6	ENSG00000113273	−9.47	−7.1	−2.37
hsa-miR-98-5p	UUUACUCAACCGCUACUUUAGAC	11659–11681	ORF1ab, nsp6	ENSG00000205250	−11.7	−10.7	−1
hsa-miR-26a-2-3p	UCAAGAAAUUCAAC	28853–28866	ORF9, nucleocapsid protein	ENSG00000171772	−6.98	−6.3	−0.68
hsa-miR-192-3p	UCUUGUCUGUUAAUC	16361–16375	ORF1ab, nsp13-ZBD	ENSG00000185658	−6.98	−6.7	−0.28