Table 5 . The designed siRNAs for the selected UCRs.
The first column indicates the location in SARS-CoV-2 that the designed siRNAs target these regions. The two subsequent columns contain the guide and passenger strands of the designed siRNAs. The next column shows the melting temperature for the seed-target duplex forming in the guide and passenger strands of the designed siRNAs. The next column denotes the satisfaction status of proposed siRNAs in the constraint of not containing more than 3 continuous “C”s or “G”s. The last column shows the “GC” content in the designed siRNAs.
| UCR location | siRNA guide sequence | siRNA passenger sequence | Seed-duplex stability | Contiguous (G/C) | GC content (%) |
|---|---|---|---|---|---|
| 6760–6782 | AAAUAAGGCAUAUAAUUAGUA | CUAAUUAUAUGCCUUAUUUCU | (10.9 °C, − 8 °C) | yes | <30 |
| 6757–6779 | UAAGGCAUAUAAUUAGUACAA | GUACUAAUUAUAUGCCUUAUU | (30.5 °C, 6.3 °C) | yes | <30 |
| 17762–1774 | UAUAAGGUGAAAUAAAGACAG | GUCUUUAUUUCACCUUAUAAU | (18.5 °C, 6.9 °C) | yes | <30 |
| 10009–10031 | AGAGGUUUGUGGUGGUUGGUA | CCAACCACCACAAACCUCUAU | (25.4 °C, 30.5 °C ) | yes | <30 |
| 23910–23932 | UGUAAAUUUGUUUGACUUGUG | CAAGUCAAACAAAUUUACAAA | (−0.3 °C, 19.2 °C ) | yes | <30 |