Table 2.
The primer pairs for qRT-PCR validation.
| Primers | Sequence (5'-3') |
|---|---|
| H2BE-F | agtggctgagttcggctgtc |
| H2BE-R | gctgccaagcgtcagtcata |
| U6b-F | ggcagtcgaccgacgaata |
| U6b-R | cgtgaaagaccgcagcaa |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.