Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for the Spike generation constructs.
| RNA Oligonucleotide | Sequence Targeted Regions |
|---|---|
|
SARS-CoV-2_N_F1 (28260–28376) |
AUGUCUGAUAAUGGACCCCAAAAUCAGCGAAAUGCACCCCGCAUUACGUUUGGUGGACCCUCAGAUUCAACUGGCAGUAACCAGAAUGGAGAACGCAGUGGGGCGCGAUCAAAACAA |
|
SARS-CoV-2_E (26255–26376) |
ACAGGUACGUUAAUAGUUAAUAGCGUACUUCUUUUUCUUGCUUUCGUGGUAUUCUUGCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGUGUGCGUACUGCUGCAAUAU |
Notes: in parenthesis are reported the reference regions targeted in terms of 5′–3′ nucleotides.
