Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (D. melanogaster) | w; MyoIA-Gal4; tub-Gal80ts, UAS-GFP | Edgar Bruce lab | ||
| Genetic reagent (D. melanogaster) | w; esg-Gal4, tub-Gal80ts UAS-GFP | Edgar Bruce lab | ||
| Genetic reagent (D. melanogaster) | w; Prospero-Gal4 | Edgar Bruce lab | ||
| Genetic reagent (D. melanogaster) | w; Dl-Gal4/TM6, Tb | Edgar Bruce lab | ||
| Genetic reagent (D. melanogaster) | Su(H)-Gal4 | Sarah Bray lab | ||
| Genetic reagent (D. melanogaster) | Notch-reporter 3.37-gh-LacZ | Sarah Bray lab | ||
| Genetic reagent (D. melanogaster) | M5-4::LacZ | Erika Matunis | ||
| Genetic reagent (D. melanogaster) | UAS-LamC | Lori Walworth | ||
| Genetic reagent (D. melanogaster) | UAS-Non-stop RNAi | Bloomington | 28725 | |
| Genetic reagent (D. melanogaster) | UAS-Non-stop RNAi | VDRC | 45775/GD ; 45776/GD | |
| Genetic reagent (D. melanogaster) | UAS-GFP | Bloomington | # 1521 | |
| Genetic reagent (D. melanogaster) | UAS-GCN5-RNAi | Bloomington | # 33981 | |
| Genetic reagent (D. melanogaster) | UAS-SGF11-RNAi | VDRC | 17166/GD;100581/KK | |
| Genetic reagent (D. melanogaster) | UAS-Su(Hw)-RNAi | Bloomington | # 33906 | |
| Genetic reagent (D. melanogaster) | UAS-LacZ | Bloomington | #1776 | |
| Genetic reagent (D. melanogaster) | UAS-Atx7-RNA-i | VDRC | 102078/KK | |
| Genetic reagent (D. melanogaster) | UAS-e(y)2 RNAi | VDRC | 16751/GD ; 108212/KK | |
| Genetic reagent (D. melanogaster) | UAS-e(y)2 RNAi | Bloomington | 42524 | |
| Genetic reagent (D. melanogaster) | UAS-CP-190 RNAi | Bloomington | 42536 | |
| Genetic reagent (D. melanogaster) | UAS-Nup98-96 RNAi | Bloomington | #28562 | |
| Genetic reagent (D. melanogaster) | UAS-mod(mdg4) RNAi | Bloomington | # 32995 | |
| Genetic reagent (D. melanogaster) | “G-TRACE” (w*; P{UAS-RedStinger}6, P{UAS-FLP.Exel}3, P{Ubi-p63E(FRT.STOP)Stinger}15F2.) | Bloomington | #28281 | |
| Genetic reagent (Yeast) | pJ69-4A (MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4Δ gal80Δ GAL2-ADE2 LYS2::GAL1-HIS3 met2::GAL7-lacZ) | |||
| Antibody | anti-Prospero (Mouse monoclonal (IgG1)) | DHSB | Prospero (MR1A) | (1:100) |
| Antibody | anti-Armadillo (Mouse monoclonal) | DHSB | N2 7A1 Armadillo | (1:500) |
| Antibody | anti-Delta (Mouse monoclonal(IgG1)) | DHSB | C594.9B | (1:50) |
| Antibody | anti 4F3 anti-discs large (Dlg) (Mouse monoclonal) | DHSB | 4F3 anti-discs | (1:50) |
| Antibody | anti-HP1(Rabbit polyclonal) | Susan Purkhurst lab | (1:1000) | |
| Antibody | anti-mTor (Mouse monoclonal(IgG1)) | DHSB | 12F10-5F11 | (1:100) |
| Antibody | anti-βGal(Rabbit polyclonal) | MP Biomedicals | 55976 | (1:500) |
| Antibody | anti-Actin (Mouse monoclonal) | MP Biomedicals | 691001 | (WB) (1:4000) |
| Antibody | anti-MESH (Rabbit polyclonal) |
Mikio Furuse lab | (1:100) | |
| Antibody | anti-SSK (Rabbit polyclonal) | Mikio Furuse lab | (1:100) | |
| Antibody | anti-caudal (Guinea Pig Polyclonal) | Jeff Reinitz lab | (1:200) | |
| Antibody | anti-odd-skipped (Guinea Pig Polyclonal) (Rat Polyclonal) | Jeff Reinitz lab | (1:100) | |
| Antibody | anti Lamin C (Mouse monoclonal) | Yossef Gruenbaum lab | (1:500) | |
| Antibody | anti Otefin (Mouse monoclonal) | Yossef Gruenbaum lab | (1:10) | |
| Antibody | anti-Lamin Dm0(Rabbit polyclonal) | Yossef Gruenbaum lab | (1:300) | |
| Antibody | anti-p-histone H3 (Rabbit polyclonal) | Abcam | ab5176 | (1:100) |
| Antibody | anti-Nop60B (Rabbit polyclonal) | Steven Pole lab | (1:100) | |
| Antibody | Guinee pig anti-Coilin | Joseph Gall lab | (1:2000) | |
| Antibody | anti-Non-stop(Rabbit polyclonal) | Cloud et al., 2019 | (1:100) | |
| Antibody | anti-PCNA (Rabbit polyclonal) | Bruce Edgar Lab | (1:100) | |
| Antibody | anti-Nup98 (Rabbit polyclonal) | Cordula Schlutz Lab | (1:100) | |
| Antibody | anti-e(y)2 (Rabbit polyclonal) | Cloud et al., 2019 | (1:1000 - WB, 1:100 - IHC) | |
| Antibody | anti-Cp190 (Rabbit polyclonal) | Golovnin et al., 2007 | (1:1000WB), (1:100 IHC) | |
| Antibody | anti-mod (MDG4) (Mouse monoclonal) | Golovnin et al., 2007 | ( 1:100 IHC) | |
| Antibody | anti-H1 (Rabbit polyclonal) | Bas Van-Steensel lab | (1:500) (1:1000WB) | |
| Antibody | anti-H2Bub (Mouse monoclonal) | Moshe Oren Lab | (1:500) | |
| Antibody | anti-H2B (Mouse monoclonal) | Moshe Oren Lab | (1:500) | |
| Antibody | anti-Pdm1 (Rabbit polyclonal) | Di´az-Benjumea lab | (1:50) | |
| Antibody | Alexa Fluor 568 goat anti-mouse IgG1(γ1) | invitrogen | A21124 | (1:1000) |
| Antibody | Alexa Fluor 568 goat anti-mouse IgG (H+L) | invitrogen | A11031 | (1:1000) |
| Antibody | Alexa Fluor 568 goat anti-rabbit IgG (H+L) | invitrogen | A11036 | (1:1000) |
| Antibody | Alexa Fluor 633 goat anti-rabbit IgG (H+L) | invitrogen | A-21070 | (1:1000) |
| Antibody | Alexa Fluor 633 goat anti-mouse IgG1 (γ1) | invitrogen | A-21126 | (1:1000) |
| Antibody | Alexa Fluor 568 goat anti-guinea pig | invitrogen | A11075 | (1:1000) |
| Antibody | Alexa Fluor 633 goat anti-guinea pig | invitrogen | A21105 | (1:1000) |
| Antibody | Alexa Fluor 633 goat anti-rat | invitrogen | A21094 | (1:1000) |
| Antibody | Alexa Fluor 568 goat anti-rat | invitrogen | A11077 | (1:1000) |
| sequence-based reagent | CP190 CT (aa, 468-1096) | pET32a(+) vector (merck) | 5’-tttggtaccgggccctggctgtgcctg-3’ | |
| Sequence-based reagent | CP190 CT (aa, 468-1096) | pET32a(+) vector (merck) | 5’-tttctcgagtgcggccgcagatcttag-3’ | |
| Sequence-based reagent | CP190 NT (aa, 1-524) | pET32a(+) vector (merck) | 5’- tttcatatgggtgaagtcaagtccgtg -3’ | |
| Sequence-based reagent | CP190 NT (aa, 1-524) | pET32a(+) vector (merck) | 5’- tttctcgagcatgtggaaatgcagttcccg -3’ | |
| Sequence-based reagent | e(y)2 | pET32a(+) vector (merck) | 5’- tttggatccccggaattcccgacgatgag-3’ | |
| Sequence-based reagent | e(y)2 | pET32a(+) vector (merck) | 5’- tttgcggccgcttaggattcgtcctctggc-3’ | |
| Sequence-based reagent | Non-Stop (aa 496) | pGBT9 vector (Clontech) | 5’-ttgaattcatgtccgagacgggttgtc-3’ | |
| Sequence-based reagent | Non-Stop (aa 496) | pGBT9 vector (Clontech) | 5’-ttgtcgacttactcgtattccagcacatt-3’ | |
| Sequence-based reagent | CP190 (aa 1096) | pGAD424 vector (Clontech) | 5’-ttcccgggcatgggtgaagtcaagtccg-3’ | |
| Sequence-based reagent | CP190 (aa 1096) | pGAD424 vector (Clontech) | 5’-tttggaggagctatatttactaagatct-3’ | |
| Sequence-based reagent | CP190 from first to fourth zinc fingers | pGAD424 vector (Clontech) | 5’-ttgaattcgagaatactactgggccct-3’ | |
| Sequence-based reagent | CP190 from first to fourth zinc fingers | pGAD424 vector (Clontech) | 5’-ttgtcgacgccatcctccaaagcctg-3’ | |
| Sequence-based reagent | CP190 from second to third | pGAD424 vector (Clontech) | 5’-ttgaattcgcgctttgtgagcattgc-3’ | |
| Sequence-based reagent | CP190 from second to third | pGAD424 vector (Clontech) | 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ | |
| Sequence-based reagent | CP190Δ4 | pGAD424 vector (Clontech) | 5’-aaggtaccggagcaggctttgga-3’ | |
| Sequence-based reagent | CP190Δ4 | pGAD424 vector (Clontech) | 5’-aaggtacccactgctgcttgttgtcg-3’ | |
| Sequence-based reagent | CP190Δ3-4 | pGAD424 vector (Clontech) | 5’-aaggtaccggagcaggctttgga | |
| Sequence-based reagent | CP190Δ3-4 | pGAD424 vector (Clontech) | 5’-aaggtaccaacgtatacagcagcgac-3’ | |
| Sequence-based reagent | CP190Δ2-4 | pGAD424 vector (Clontech) | 5’-aaggtaccggagcaggctttgga | |
| Sequence-based reagent | CP190Δ2-4 | pGAD424 vector (Clontech) | 5’-aaggtacccgcgccggatcaattg-3’ | |
| Sequence-based reagent | CP190Δ1-4 | pGAD424 vector (Clontech) | 5’-gccctggctgaaggagcaggctttggagga | |
| Sequence-based reagent | CP190Δ1-4 | pGAD424 vector (Clontech) | 5’-cctgctccttcagccagggcccagtagtat-3’ | |
| Cell line (D. melanogaster) | S2 | |||
| recombinant DNA reagent | pY3H | |||
| recombinant DNA reagent | pRmha3 C-HAx2-FLx2-nonstop-735 | Cloud et al., 2019 | ||
| Transfected construct (Drosophila S2 Cells) | Non-Stop-RNAi forward | 5’-cggaattccgaattaatacgactcactatagggatttaatctggaaccatgcgaa-3’ | ||
| Transfected construct (Drosophila S2 Cells) | Non-Stop-RNAi reverse | 5’-cggaattccgaattaatacgactcactatagggaaatgtcccaaaacggatcgta-3’ | ||
| Chemical compound, Drug | Diamidino-2-phenylindole*dihydrochl [DAPI] 1mg | Sigma | D9542-1MG | 1:1000 |
| Chemical compound, Drug | Bromophenol Blue | Sigma | #B5525 | |
| Chemical compound, Drug | Guanidine hydrochloride | Sigma | #G4505 | |
| Chemical compound, Drug | NP40 (Igepal CA-630) | Sigma | #I3021 | |
| Chemical compound, Drug | Triton X-100 | Amresco | #0694 | |
| Chemical compound, Drug | Acrylamide (Bis-Acrylamide 29:1) | Biological Industries | #01-874-1A | |
| Chemical compound, Drug | Ammonium Persulfate | Sigma | #A-9164 | |
| Chemical compound, Drug | TEMED | Sigma | #T-7024 | |
| Chemical compound, Drug | L-Glutamine | Gibco | #25030024 | |
| Chemical compound, Drug | MG132 | Boston Biochemicals | ||
| Chemical compound, Drug | Blot Qualified BSA | Biological Industries | #PRW3841 | |
| Chemical compound, Drug | Agarose | SeaKem LE Agarose- Cambrex Bio Science | #CAM-50004 | |
| Chemical compound, Drug | Bradford Protein Assay | BioRad | #500-0006 | |
| Chemical compound, Drug | EZ-ECL | Biological Industries | #20-500-500 | |
| Chemical compound, Drug | FD&C blue dye #1 | |||
| Chemical compound, Drug | Cyclohexamide | Sigma | #01810 |