Table 4.
CpG classes: sequences, structure, interaction with Toll-like receptor 9 (TLR9), and response induced in immune cells.
| CpG-ODN type | Sequence example | Structure | Effect on Immune cells |
|---|---|---|---|
| A-class (D-type) | GGTGCPuPy CG PuPyGCAGGGGGG | Single CpG motif flanked by a palindromic sequence, plus a 3’ Poly-G end. Mixed phosphodiester/phosphorothioate backbone. |
• IFNγ production by NK cells (83)§
• Lytic activity by NK cells (128)§# • Type 1 IFN production by pDC (85, 129, 130)§# |
| B-class (K-type) | ATCGACTCTCGAGCGTTCTC | Multiple CpG motifs. No palindromic sequences. Phosphorothioate only backbone. |
• IgM, IL-6 production by B cells and B cell proliferation (83, 131)§
• Type 1 IFN production by pDC (85)§ • pDC maturation (130)§ • Th1 response induction (85)§ • NK cells activation (85)§ • Production of TGF-β and IDO by pDC (84, 132)§# • Tolerance induction by pDC (77, 84, 132)§# |
| C-class | TCG T CG TT CG AA CG A CGTTGAT | Multiple CpG motifs and one palindromic sequence. Phosphorothioate only backbone |
• IL-6 production by B cells (131, 133)§
• B cell activation and proliferation (134)§ • Type I IFN in pDC (130)§ • pDC maturation (130)§ |
| P-class | T CG T CG A CG AT-CG G CGCGCG C CG | Multiple CpG motifs flanked and two palindromic sequences. Phosphorothioate only backbone. |
• Type I IFN by PBMCs (135)§
• Increased plasma levels of type 1 IFN and IL-6 in vivo (135)§ |
Pu, purine nucleotide; Py, pyrimidine nucleotide; Bold, CpG motifs; Underlined, palindrome sequences; PBMCs, peripheral blood mononuclear cells. #In mouse, §In human.