KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rat monoclonal anti- mouse IL-10R Neutralizing Antibody Isotype: Rat IgG1, κ |
Bioxcell | Cat# BE-0050; RRID: AB_1107611 Isotype Cat# BE-0088; RRID: AB_1107775 |
| Anti-PE microbeads | Miltenyi Biotec | Cat# 130-048-801; RRID: AB_244373 |
| Rabbit polyclonal anti-HDAC3 | Abcam | Cat# ab7030; RRID: AB_305708 |
| Rabbit Polyclonal anti- NCOR | Abcam | Cat# ab3482; RRID: AB_10860296 |
| Rabbit Polyclonal anti-DDDDK tag(FLAG sequence) | Abcam | Cat# ab1162; RRID: AB_298215 |
| Rabbit Polyclonal anti-PPARγ | Abcam/ SantaCruz Biotechnology | Cat# ab19481/sc7273; RRID: AB_444944/AB_628115 |
| Rabbit Polyclonal anti-phospo-PPARγ (Ser112) | Thermo | Cat# PA5-36763; RRID: AB_2553712 |
| Rabbit Polyclonal anti-SUMO-1 | Cell Signaling Technology | Cat# 4930; RRID: AB_10698887 |
| PE Rat Monoclonal anti-CD11b (clone:M1/70), Isotype: PE Rat IgG2b,κ | Biolegend | Cat# 101207; RRID: AB_312790 isotype Cat# 400607; RRID: AB_326551 |
| PerCP/Cy5.5 Rat Monoclonal anti-F4/80 (clone:BM8) Isotype: PerCP/Cy5.5 Rat IgG2a, κ | Biolegend | Cat# 123127; RRID: AB_893496 Isotype Cat# 400531; RRID: AB_2864286 |
| PE/Cyanine5 Rat Monoclonal anti-Ly6G(Gr-1) (Clone: RB6-8C5); Isotype: PE/Cyanine5 Rat IgG2b κ | Biolegend | Cat# 108409; RRID: AB_313374 Isotype Cat# 400609; RRID: AB_326553 |
| PE/Cyanine7 Rat Monoclonal anti-Ly6C(clone: HK1.4) Isotype: PE/Cyanine7 Rat IgG2c κ | Biolegend | Cat# 128017; RRID: AB_1732093 Isotype Cat# 400721 |
| FITC Rat monoclonal anti- IL-10(Clone: JES5-16E3) | Biolegend | Cat# 505005; RRID: AB_315359 |
| Isotype: Rat IgG2b, κ | Isotype Cat# 400633; RRID: AB_893678 | |
| Alexa Fluor 488 Donkey anti-Rabbit IgG (H+L) | Molecular Probes | Cat# A-21206; RRID: AB_2535792 |
| Peroxidase Goat Anti-Rabbit IgG(H+L) | Jackson ImmunoResearch Labs | Cat# 111-035-003; RRID: AB_2313567 |
| Bacterial and virus strains | ||
| Klebisella pneumoniae pneumoniae | ATCC | ATCC 43816 |
| Chemicals, peptides, and recombinant proteins | ||
| Non-Viral in vivo transfection reagent | Polyplus Transfection | in vivo – jetPEI® |
| D-JNK-1 Inhibitor (AM-111/XG-102/Brimapitide, 0.3mg/kg or final concentration 2 μM) | Medchem Express | Cat#HY-P0069 |
| Lipopolysaccharide from Escherichia coli O26:B6 | Sigma Aldrich | Cat# 2654 |
| Collagenase from Clostridium histolyticum | Roche | Cat#10103586001 |
| DNAaseI from Bovine Pancreas | Roche | Cat#11284932001 |
| KAPA SYBR FAST qPCR mastermix | Roche | Cat#KK4602 |
| Prolong™ anti-fade mountant with DAPI | Invitrogen | Cat# P36966 |
| cOmplete ™ EDTA-free Protease Inhibitor Cocktail | Roche | Cat#04693159001 |
| phosSTOP ™ Phosphatase Inhibitor | Roche | Cat#04906837001 |
| Cell Lysis Buffer (10X) | Cell Signaling Technology | Cat#9803 |
| Cardiolipin Sodium from Bovine Heart | Avanti Polar Lipids | Cat#840012C |
| MEK/Erk MAPK Inhibitor (U0126, Final Conc. 20 μM) | Cell Signaling Technology | Cat#9903S |
| P38 MAPK inhibitor (SB203580, Final Conc. 10 μM) | Sigma Aldrich | Cat#S8307 |
| CDK9 Inhibitor (SNS-032, Final Conc. 10nM) | MedChem Express | Cat#HY-10008 |
| Fixation/Permeabilization solution (Cytofix/ Cytoperm) | Becton, Dickinson and company | Cat#554722 |
| Viability Dye (SYTOX Green Ready Flow Reagent) | Invitrogen | Cat#R37168 |
| Gentamicin | GIBCO | Cat#15750078 |
| Critical commercial assays | ||
| Mouse IL-10 DuoSet ELISA kit | RnD systems | Cat#DY417 |
| Mouse TNFα DuoSet ELISA kit | RnD systems | Cat#DY410 |
| Mouse Albumin ELISA kit | Abcam | Cat#ab108792 |
| Mouse macrophage nucleofector kit | Lonza | Cat# VPA-1009 |
| Chromaflash high sensitivity ChIP kit | Epigentek | Cat# P-2027-48 |
| Pierce Crosslink Immunoprecipitation kit | Thermo Scientific | Cat# 26147 |
| RNeasy kit for RNA isolation | QIAGEN | Cat# 74106 |
| HighCapacity cDNA reverse transcription kit | Applied Biosystems | Cat# 4368814 |
| QuikChange II XL Site-Directed Mutagenesis Kit | Agilent | Cat#200521 |
| Deposited data | ||
| Mendeley Data | This paper | https://doi.org/10.17632/xdgghg2jpt.1 |
| Experimental models: cell lines | ||
| Murine macrophage cell line: RAW264.7 | ATCC | ATCC TIB-71; RRID:CVCL_0493 |
| Experimental models: organisms/strains | ||
| Mouse: C57BL/6 | The Jackson Laboratory | RRID: IMSR_JAX:000664 |
| Oligonucleotides | ||
| esiRNA targeting mouse PIAS1 | Sigma-Aldrich | Cat# EMU076871 |
| esiRNA targeting mouse PIAS2 | Sigma-Aldrich | Cat# EMU090071 |
| esiRNA targeting mouse PIAS3 | Sigma-Aldrich | Cat# EMU026711 |
| esiRNA targeting mouse PIAS4 | Sigma-Aldrich | Cat# EMU062861 |
| Scrambled Control siRNA | SantaCruz Biotech | Cat# sc37007 |
| PCR primers for mouse PIAS1: FP atcaggtagcgtcccacaac/RP cgaggcttgatgaggaagac |
This paper (Synthesized on order by IDT) | N/A |
| PCR primers for mouse PIAS2: FP gactttgcttggcagagacc/RP ttggcacagctgaagacaac |
This paper (Synthesized on order by IDT) | N/A |
| PCR primers for mouse PIAS3: FP ggacgtgtcctgtgtgtgac /RP ctctgatgcctccttcttgg |
This paper (Synthesized on order by IDT) | N/A |
| PCR primers for mouse PIAS4: FP gcctggtgtggaacctaaga /RP atagttgccccaggtgacag |
This paper (Synthesized on order by IDT) | N/A |
| PCR primers for mouse hprt: FP agtcccagcgtcgtgattag /RP tgatggcctcccatctcctt |
This paper (Synthesized on order by IDT) | N/A |
| PCR primers for mouse IL-10 promoter: FP tatcggacgttcaacccagg/ RP ggccctcatctgtggattcc |
(Chakraborty et al., 2017) (Synthesized on order by IDT) | PMID: 28074841 |
| Recombinant DNA | ||
| pCDNA flag PPAR gamma plasmid | (Hauser et al., 2000) | Addgene plasmid#8895; RRID#Addgene_8895 |
| PPARγ S112A mutant | This paper | N/A |
| pLpA-DN.JNK1 | (Liang et al., 2003) | Addgene plasmid#51942 RRID:Addgene_51942 |
| Software and algorithms | ||
| ImageJ | (Schneider et al., 2012) | RRID:SCR_003070 |
| FlowJo ver 10.7.1 | Becton Dickinson & Co. | RRID:SCR_008520 |
| Prism 8 | GraphPad Software | RRID:SCR_002798 |
| NIS Elements | Nikon | RRID:SCR_014329 |