Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Name | Position | Length | Sequence | Minimum free energy (kcal/mol) | Target |
| hsa-miR-1273f | 261~279 | 19 | GCTAACAACCTCCATCTCA | -23.00 | MDM2 |
| hsa-miR-4726-5p | 197~218 | 22 | CCACTCCGGGACTCCTGGCCCC | -27.70 | SHP-1 |
| hsa-miR-2115-5p | 442~462 | 21 | AGCAGCAGGAGTTTGGAAGCC | -15.02 | Erbb2 |
| hsa-miR-4649-5p | 200~225 | 26 | CTCCGGGACTCCTGGCCCCTCGCCCT | -28.10 | MLLT6 |
