KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | DENTIFIER |
|---|---|---|
| Antibodies | ||
| CD150-PE | Biolegend | 115904; RRID: AB_313683 |
| CD48-APC | Biolegend | 103412; RRID: AB_571997 |
| Sca-1-PercpCy5.5 | Biolegend | 108124; RRID: AB_893615 |
| CD201(EPCR)-APC | Biolegend | 141505; RRID: AB_ 2561361 |
| CD48-BV711 | Biolegend | 103439; RRID: AB_2650824 |
| CD2-FITC | Biolegend | 100105; RRID: AB_312652 |
| CD3-FITC | Biolegend | 100204; RRID: AB_312661 |
| CD8a-FITC | Biolegend | 100706; RRID: AB_312745 |
| B220-FITC | Biolegend | 103206; RRID: AB_312991 |
| Gr-1-FITC | Biolegend | 108406; RRID: AB_313371 |
| Ter119-FITC | Biolegend | 116206; RRID: AB_313707 |
| CD2-APC | Biolegend | 100111; RRID: AB_2563089 |
| CD3-APC | Biolegend | 100235; RRID: AB_2561455 |
| CD8a-APC | Biolegend | 100711; RRID: AB_312750 |
| B220-APC | Biolegend | 103211; RRID: AB_312996 |
| Gr-1-APC | Biolegend | 108411; RRID: AB_313376 |
| Ter119-APC | Biolegend | 116211; RRID: AB_313712 |
| CD2-PE-Cy7 | Biolegend | 300221; RRID: AB_2572065 |
| CD3-PE-Cy7 | Biolegend | 100219; RRID: AB_1732068 |
| CD8a-PE-Cy7 | Biolegend | 100721; RRID: AB_312760 |
| B220-PE-Cy7 | Biolegend | 103221; RRID: AB_313004 |
| Gr-1-PE-Cy7 | Biolegend | 108415; RRID: AB_313380 |
| Ter119-PE-Cy7 | Biolegend | 116223; RRID: AB_2137788 |
| CD48-PE-Cy7 | Biolegend | 103424; RRID: AB_2075049 |
| CD16/32-BV711 | Biolegend | 101337; RRID: AB_2565637 |
| CD105-APC | Biolegend | 120414; RRID: AB_2277914 |
| CD45.1-APC-Cy7 | Biolegend | 110716; RRID: AB_313505 |
| CD45.2-FITC | Biolegend | 109806; RRID: AB_313443 |
| CD45.2-AF700 | Biolegend | 109822; RRID: AB_493731 |
| CD11b-APC | Biolegend | 101212; RRID: AB_312795 |
| Gr-1-PE-Cy7 | Biolegend | 108416; RRID: AB_313381 |
| B220-PercpCy5.5 | Biolegend | 103236; RRID: AB_893354 |
| CD41-AF700 | Biolegend | 133925; RRID: AB_2572129 |
| CD3-PE | Biolegend | 100206; RRID: AB_312663 |
| CD135-Biotin | Biolegend | 135307; RRID: AB_1953266 |
| CD117-APC-Cy7 | Biolegend | 105826; RRID: AB_1626278 |
| H2A.X Phospho(Ser139) -AF647 | Biolegend | 613407; RRID: AB_2114994 |
| CD117-Biotin | Biolegend | 135804; RRID: AB_313213 |
| CD117-PE-Cy7 | Biolegend | 105814; RRID: AB_313223 |
| CD244.2-AF647 | Biolegend | 133509; RRID: AB_2072854 |
| CD229-Biotin | Biolegend | 122903; RRID: AB_830724 |
| CD41-AF700 | Biolegend | 133925;RRID: AB_2572129 |
| CD34-FITC | Thermo Fisher | 16-0341-85; RRID: AB_468937 |
| H3K4me1 | Diagenode | C15410194; RRID: AB_2637078 |
| H3K27ac | Diagenode | C15410196; RRID: AB_2637079 |
| Anti-MLL3 | Sigma-Aldrich | ABE1851 |
| Anti-NUP98 | Cell Signaling | 2288;RRID: AB_561204 |
| P-JNK | Cell Signaling | 4688; RRID: AB_823588 |
| P-p38 | Cell Signaling | 4511; RRID: AB_2139682 |
| P-p65 | Cell Signaling | 3033;RRID: AB_331284 |
| JNK | Cell Signaling | 9252; RRID: AB_2250373 |
| α-Tubulin | Cell Signaling | 2144;RRID: AB_2210548 |
| Chemicals, peptides, and recombinant proteins | ||
| Streptavidin-PE-Cy7 | Biolegend | 405206 |
| Streptavidin-APC-Cy7 | Biolegend | 405208 |
| Steptavidin-BV711 | Biolegend | 405241 |
| Mojosort Streptavidin Nanobeads | Biolegend | 76447 |
| Tamoxifen | Cayman Chemical | 13258 |
| Cyclophosphamide for injection (500mg/vial) | Sandoz | |
| 5-Fluorouracil | Sigma-Aldrich | F6627–5G |
| Recombinant Murine IL-1β | Peprotech | 211–11B |
| Recombinant Murine TNF-α | Peprotech | 315–01A |
| Bromo-deoxyuridine | Sigma-Aldrich | B5002 |
| Recombinant murine TPO | Peprotech | 315–14 |
| Recombinant murine SCF | Peprotech | 250–03 |
| Iscove’s Modified Dulbecco’s Medium | Thermo Fisher Scientific | 31980030 |
| MethoCult™ GF M3434 | Stem cell technologies | 03434 |
| DirectPCR lysis reagent (Mouse Tail) | Viagen | 101-T |
| StemSpan™ SFEM | Stem cell technologies | 09650 |
| 2’,7’-Dichlorofiuorescin diacetate | Sigma-Aldrich | D6883–50MG |
| Polyinosinic-polycytidylic acid sodium salt | Sigma-Aldrich | P1530 |
| NuPAGE™ LDS Sample Buffer (4X) | Thermo Fisher Scientific | NP0007 |
| SuperSignal™ West Femto Maximum sensitivity Substrate | Thermo Fisher Scientific | 34095 |
| Critical commercial assays | ||
| APC BrdU Flow Kit | BD | 51–9000019AK |
| RNeasy Plus Micro Kit | QIAGEN | 74034 |
| MinElute Reaction Cleanup Kit | QIAGEN | 28204 |
| Illumina Tagment DNA Enzyme and Buffer (Small Kit) | Illumina | 20034210 |
| Sera-Mag Speedbeads | Fisher | 09-981-123 |
| NEBNext High-Fidelity 2X PCR Master Mix | NEB | M0541S |
| Coomassie Plus (Bradford) Assay Kit | Thermo | 23236 |
| Ampure XP SPRI Beads | Beckman | B23318 |
| NuPage™ 4 to 12% Bis-Tris Gel (10-well) | Thermo Fisher Scientific | NP0335PK2 |
| Deposited data | ||
| ATAC-seq | This paper | GEO: GSE158158 |
| RNA-seq | This paper | GEO: GSE158160 |
| ChIPmentation | This paper | GEO: GSE158159 |
| Series entry (encompassing all datasets) | This paper | GEO: GSE158162 |
| Experimental models: organisms/strains | ||
| Mouse: C57BL/6J | The Jackson Laboratory | RRID:IMSR_JAX:006965 |
| Mouse: B6;129S4-Gt(ROSA)26Sortm1(rtTA*M2)JaeCol1a1tm7(tetO-HIST1H2BJ/GFP)Jae/j | The Jackson Laboratory | RRID:IMSR_JAX:016836 |
| Mouse: C57BL/6N-Fgd5tm3(cre/ERT2)Djr/J | The Jackson Laboratory | RRID:IMSR_JAX:027789 |
| Mouse: B6.Cg-Commd10TgVav1-icre)A2Ko/J | The Jackson Laboratory | RRID:IMSR_JAX:008610 |
| Mouse: B6.C-Tg(CMV-cre)1Cgn/J | The Jackson Laboratory | RRID:IMSR_JAX:006054 |
| Mouse: Kmt2c-null | This paper | N/A |
| Mouse: Kmt2c-fiox | This paper | N/A |
| Oligonucleotides | ||
| Primer for the exon 14 germline Kmt2c mutation genotyping: Forward: GTGACTTAATACGACTC ACTATAGGGCCAACAACAT ACATCTCAGTC | This paper | N/A |
| Primer for the exon 14 germline Kmt2c mutation genotyping: Reverse: TGTATTGCAGGGAAAGT AAATGTT | This paper | N/A |
| Primer for the exon 3 conditional fioxed allele genotyping: Forward: GAACCTGAGGCTGT CGAAGG | This paper | N/A |
| Primer for the exon 3 conditional fioxed allele genotyping: Reverse: AGCCATTAAACTTAGTGAAGACCA | This paper | N/A |
| Primer for the exon 3 conditional to identify deletec allele: Forward: GCTCCTCCTCTGGCTTCCA AGGTCA | This paper | N/A |
| Primer for the exon 3 conditional to identify deleted allele: Reverse: AGGGCATCTAATCTGACAGCTGTAAGC | This paper | N/A |
| ATAC-seq and ChIPmentation primers | Buenrostro et al., 2013 | N/A |
| Software and algorithms | ||
| STAR version 2.0.4b | (Dobin et al., 2013) | https://github.com/alexdobin/STAR |
| GAGE (Generally Applicable Gene-set Enrichment) | (Luo et al., 2009) | https://bioconductor.org/packages/release/bioc/html/gage.html |
| Reactome | (Joshi-Tope et al., 2005) | https://reactome.org |
| limma/voom | (Ritchie et al., 2015) | https://www.bioconductor.org/packages/release/bioc/html/limma.html |
| ATAC-seq and DNase-seq processing pipeline, v0.3.3 | (Kundaje et al., 2015) | https://github.com/kundajelab/atac_dnase_pipelines |
| AQUAS TF and histone ChIP-seq pipeline, v0.3.3 | (Kundaje et al., 2015) | https://github.com/kundajelab/chipseq_pipeline |
| Bowtie2 | Bowtie, v2.2.26 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| DiffBind | DiffBind | http://www.bioconductor.org/packages/2.13/bioc/html/DiffBind.html |
| Irreproducible Discovery Rate (IDR) | (Li et al., 2011) | https://www.encodeproject.org/software/idr |
| MACS2 | MACS2, V2.1.0 | https://github.com/macs3-project/MACS |
| HOMER | (Heinz et al., 2010) | http://homer.ucsd.edu/homer/motif |
| BD FACSDiva | BD | N/A |
| Flowjo v.10 | Treestar | N/A |
| GraphPad Prism v.8 | GraphPad Software | N/A |
| WashU Epigenome browser | (Zhou et al., 2013) | https://epigenomegateway.wustl.edu |