Table 2. Primer and probe sequences for the MERS-CoV RT-qPCR assay.

Genomic target	Primer or probe	Genome location	Primer or probe
UpEa	Forward primer	27458–27475	GCAACGCGCGATTCAGTT
	Reverse primer	27549–27530	GCCTCTACACGGGACCCATA
	Probe	27477–27502	/6-FAM/CTCTTCACATAATCGCCCCGAGCTCG/BHQ1/
N2b	Forward primer	29424–29442	GGCACTGAGGACCCACGTT
	Reverse primer	29498–29477	TTGCGACATACCCATAAAAGCA
	Probe	29445–29471	/6-FAM/CCCCAAATTGCTGAGCTTGCTCCTACA/BHQ1/

a Primer/probe sequences were based on a report by Corman et al. [11].

b Primer/probe sequences were derived from a report by Lu et al. [12].

All genomic locations were based on the human betacoronavirus 2c EMC/2012 strain (GenBank: JX869059.2).