KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-p53 (DO-1) | Santa Cruz | Cat. # sc-126; RRID: AB_628082 |
| Anti-p53 (CM5p) | Leica Biosystems | Cat. # NCL-L-p53-CM5p; RRID: AB_2744683 |
| Anti-GRP94 | Santa Cruz | Cat. # sc-32249; RRID: AB_627676 |
| Anti-CD63 (for western blotting) | System Biosciences | Cat. # EXOAB-CD63A-1; RRID: AB_2561274 |
| Anti-CD63 (for immune-gold staining) | Abcam | Cat. # ab217345; RRID: AB_2754982 |
| Anti-Alix | Santa Cruz | Cat. # sc-53538; RRID: AB_673821 |
| Anti-TSG101 | Abcam | Cat. # ab30871; RRID: AB_2208084 |
| Anti-PDX1 | Cell Signaling Technology | Cat. # 5679; RRID: AB_10706174 |
| Anti-Cre | Cell Signaling Technology | Cat. # 15036; RRID: AB_2798694 |
| Anti-αSMA | Abcam | Cat. # ab5694; RRID: AB_2223021 |
| Anti-Fibronectin | Abcam | Cat. # ab2413; RRID: AB_2262874 |
| Anti-HSP90 | Cell Signaling Technology | Cat. # 4877; RRID: AB_2233307 |
| Anti-GAPDH | Sigma-Aldrich | Cat. # G8795; RRID: AB_1078991 |
| Goat-anti-Rabbit IgG (H&L) | Electron Microscopy Sciences | Cat. # 25116; RRID: N/A |
| Goat-anti-Mouse IgG (H&L) | Electron Microscopy Sciences | Cat. # 25129; RRID: N/A |
| AffiniPure Fab Fragment Goat Anti-Mouse IgG (H+L) |
Jackson ImmunoResearch | Cat. # 115-007-003; RRID: AB_2338476 |
| Peroxidase AffiniPure Goat Anti-Mouse IgG + IgM (H+L) |
Jackson ImmunoResearch | Cat. # 115-035-068; RRID: AB_2338505 |
| Peroxidase AffiniPure F(ab’)2 Fragment Goat Anti-Rabbit IgG, F(ab’)2 fragment specific |
Jackson ImmunoResearch | Cat. # 111-036-047; RRID: AB_2337945 |
| HRP Goat Anti-Rat Ig | BD Biosciences | Cat. # 554017; RRID: AB_395211 |
| ECL Anti-Rabbit IgG, Horseradish Peroxidase | GE Healthcare | Cat. # GENA934; RRID: AB_2722659 |
| ECL Anti-Mouse IgG, Horseradish Peroxidase | GE Healthcare | Cat. # NA931; RRID: AB_772210 |
| CD140a (PDGFRA) Monoclonal Antibody (APA5), PE, eBioscience | Thermo Fisher Scientific | Cat. # 12-1401-81; RRID: AB_657615 |
| APC anti-mouse CD45 Antibody | BioLegend | Cat. # 103111; RRID: AB_312976 |
| CD326 (EpCAM) Monoclonal Antibody (G8.8), eFluor 450, eBioscience | Thermo Fisher Scientific | Cat. # 48-5791-82; RRID: AB_10717090 |
| Anti-CD31 antibody [390] (PE/Cy7) | Abcam | Cat. # ab46733; RRID: AB_868905 |
| Bacterial and virus strains | ||
| Stellar Competent Cells | Clontech | Cat. # 636763 |
| Firefly Luciferase Lentifect Purified Lentiviral Particles | Genecopoeia | Cat. # LPP-FLUC-Lv100c |
| Biological samples | ||
| Patients with HGSOC (serum and tissues) | MDACC | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Nutlin-3A | Sigma-Aldrich | Cat. # SML0580 |
| 17-AAG | SelleckChem | Cat. # S1141-25MG |
| ML385 | Millipore Sigma | Cat. # SML1833-5MG |
| VER-155008 | Cayman Chemical | Cat. # 1134156-31-2 |
| Tris base | Thermo Fisher Scientific | Cat. # BP152-5 |
| NaCl | Thermo Fisher Scientific | Cat. # AC424290050 |
| Glycine | Thermo Fisher Scientific | Cat. # BP381-5 |
| Sucrose | Sigma-Aldrich | Cat. # 84097-1KG |
| Deuterium oxide | Sigma-Aldrich | Cat. # 151882 |
| Glutaraldehyde solution | Sigma-Aldrich | Cat. # G7651-10ML |
| Proteinase K | Sigma-Aldrich | Cat. # P6556-100MG |
| Ampicillin | Sigma-Aldrich | Cat. # 10835269001 |
| Triton X-100 | Thermo Fisher Scientific | Cat. # BP151-500 |
| Xho I enzyme | NEB | Cat. # R0146S |
| EcoR I enzyme | NEB | Cat. # R0101S |
| Fish Gelatin | Aurion | Cat. # 900.033 |
| 10% Formalin | Thermo Fisher Scientific | Cat. # 23-305510 |
| Diva Decloaker, 10X | Biocare Medical | Cat. # SKU: DV2004 |
| Halt Protease Inhibitor Cocktail (100X) | Thermo Fisher Scientific | Cat. # 78438 |
| Luria Broth Base | Thermo Fisher Scientific | Cat. # 12795027 |
| Fisher Chemical Permount Mounting Medium | Thermo Fisher Scientific | Cat. # SP15-100 |
| TRIzol Reagent | Thermo Fisher Scientific | Cat. # 15596018 |
| SYBR Green | Thermo Fisher Scientific | Cat. # A25778 |
| FuGENE HD Transfection Reagent | Promega | Cat. # E2311 |
| Accumax | StemCell Technologies, Inc. | Cat. # 7921 |
| ACK lysing buffer | Thermo Fisher Scientific | Cat. # A1049201 |
| RIPA Lysis and Extraction Buffer | Thermo Fisher Scientific | Cat. # 89900 |
| Ghost Dye Red 710 | Tonbo Biosciences | Cat. # 13-0871-T100 |
| Epidermal Growth Factor from murine submaxillary gland | Sigma-Aldrich | Cat. # E4127-5X.1MG |
| Critical commercial assays | ||
| Universal Magnetic Co-IP Kit | Active Motif | Cat. # 54002 |
| Human Cytokine Array Kit | R&D Systems | Cat. # ARY005B |
| exoRNeasy Midi and Maxi Kit | QIAGEN | Cat. # 77144 |
| Total Exosome Isolation Reagent | Thermo Fisher Scientific | Cat. # 4478359 |
| Restore Plus Western Blot Stripping Buffer | Thermo Fisher Scientific | Cat. # 46430 |
| Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | Cat. # 23225 |
| Direct-zol RNA Kits | Zymo Research | Cat. # R2062 |
| QIAGEN Plasmid Plus Midi kit | QIAGEN | Cat. # 12945 |
| Rapid DNA Ligation Kit | Thermo Fisher Scientific | Cat. # K1423 |
| Qubit Protein Assay Kit | Thermo Fisher Scientific | Cat. # Q33212 |
| Qubit RNA HS Assay Kit | Thermo Fisher Scientific | Cat. # Q32852 |
| Verso cDNA Synthesis Kit | Thermo Fisher Scientific | Cat. # AB1453B |
| Universal Mycoplasma Detection Kit | ATCC | Cat. # 30-1012K |
| Deposited data | ||
| mRNA Array | This paper | GEO: GSE164248 |
| Uncropped western blotting | This paper | Document S1 |
| RNA Sequencing Data | This paper | GEO: GSE148698 |
| Experimental models: cell lines | ||
| H1975 | Kindly provided by Heymach lab (MDACC) | N/A |
| H1299 | Kindly provided by Heymach lab (MDACC) | N/A |
| RKO | Kindly provided by Lee Ellis lab (MDACC) | N/A |
| A549 | Kindly provided by Heymach lab (MDACC) | N/A |
| HT29 | Kindly provided by Lee Ellis lab (MDACC) | N/A |
| A2780 | MDACC cell line bank | N/A |
| LNCaP | MDACC cell line bank | N/A |
| DU145 | ATCC cell line bank | N/A |
| KLE | MDACC cell line bank | N/A |
| T47D | MDACC cell line bank | N/A |
| HEK293T | MDACC cell line bank | N/A |
| MCF7 | Kindly provided by Gabriel Lopez lab (MDACC) | N/A |
| NoF 151 fibroblasts | Kindly provided by Jinsong Liu lab (MDACC) | N/A |
| KPC PDAC cells | Kindly provided by Anirban Maitra lab (MDACC) | N/A |
| Experimental models: organisms/strains | ||
| Mouse: B6.129S2-Trp53tm1Tyj | The Jackson Laboratory | Stock No: 002101 |
| Mouse: NCRNU-F nude (NCr) | Taconic | Model #: NCRNU-F |
| Oligonucleotides | ||
| Primers for quantitative real-time RT-PCR, see Table S3 |
This paper | N/A |
| Primers for mCherry-p53 cloning plasmids, Forward: ATTACTCGAGCGATGGAGGAGCCGCAGTCAGA | This paper | N/A |
| Recombinant DNA | ||
| pLKO-p53-shRNA-427 | Todd Waldman Lab | Addgene, Plasmid # 25636 |
| pLKO.1 puro | David Sabatini Lab | Addgene, Plasmid # 1864 |
| pLenti6/V5-p53_R273H | Bernard Futscher Lab | Addgene, Plasmid # 22934 |
| pLVX-mCherry-C1 Lenti-viral vector | Clontech | Cat. # 632561 |
| Plasmid: mCherry-p53 | This paper | N/A |
| Software and algorithms | ||
| Prism Version 8.00 | GraphPad Software | https://www.graphpad.com/ |
| Ingenuity Pathway Analysis | QIAGEN Bioinformatics | https://digitalinsights.qiagen.com/ |
| NetWalker | Kakajan Komurov, Dursun S, Erdin S, Ram P.T. | https://www.netwalkersuite.org/ |
| ImageJ | NIH Image | https://imagej.nih.gov/ij/index.html |
| R version 4.0.3 limma package | Bioconductor | https://www.bioconductor.org/packages/devel/bioc/vignettes/limma/inst/doc/usersguide.pdf |
| Transcriptome Analysis Console (TAC) Software | Thermo Fisher Scientific | https://www.thermofisher.com/us/en/home/life-science/microarray-analysis/microarray-analysis-instruments-software-services/microarray-analysis-software/affymetrix-transcriptome-analysis-console-software.html |
| CorelDraw Graphic 2018 | CorelDraw | http://www.coreldraw.com/e/ |
| Adobe Photoshop CC 2018 | Adobe | https://www.adobe.com/ |