| Antibodies |
| APC anti-human CD5 (L17F12) |
BioLegend |
Cat#364016; RRID: AB_2565726 |
| FITC anti-human CD5 (L17F12) |
BioLegend |
Cat#364022; RRID: AB_2566248 |
| PE/Cy7 anti-human CD5 (UCHT2) |
BioLegend |
Cat#300622; RRID: AB_2275812 |
| BV421 anti-human CD19 (HIB19) |
BD Biosciences |
Cat#562440; RRID: AB_11153299 |
| PerCP anti-human CD19 (HIB19) |
BioLegend |
Cat#302228; RRID: AB_893272 |
| V450 anti-human CD19 (HIB19) |
BD Biosciences |
Cat#560353; RRID: AB_1645564 |
| AF-488 anti-human TCRαβ (IP26) |
BioLegend |
Cat#306712; RRID: AB_528967 |
| Pacific Blue anti-human TCRαβ (IP26) |
BioLegend |
Cat#306716; RRID: AB_1953257 |
| APC anti-human TCRαβ (IP26) |
BioLegend |
Cat#306718; RRID: AB_10612569 |
| PE anti-human IgD (IA6-2) |
BioLegend |
Cat#348204; RRID: AB_10553900 |
| PE/Cy7 anti-human IgD (IA6-2) |
BioLegend |
Cat#348210; RRID: AB_10680462 |
| FITC anti-human IgM (MHM-88) |
BioLegend |
Cat#314506; RRID: AB_493009 |
| PE-Cy7 anti-human IgG (G18-145) |
BD Biosciences |
Cat#561298; RRID: AB_10611712 |
| PE anti-human IgG (G18-145) |
BD Biosciences |
Cat#555787; RRID: AB_396122 |
| PE anti-human IgA (IS11-8E10) |
Miltenyi Biotec |
Cat#130-093-128; RRID: AB_1036158 |
| PerCP/Cy5.5 anti-human IgE (MHE-18) |
BioLegend |
Cat#325512; RRID: AB_11219590 |
| APC/Cy7 anti-human CD69 (FN50) |
BioLegend |
Cat#310914; RRID: AB_314849 |
| APC/Cy7 anti-human CD45 (HI30) |
BioLegend |
Cat#304014; RRID: AB_314402 |
| APC/efluor anti-human CD79a (HM47) 780 |
eBioscience |
Cat#47-0792-41; RRID: AB_2573967 |
| PerCP/Cy5.5 anti-human CD79b (3A2-2E7) |
BioLegend |
Cat#341408; RRID: AB_2075869 |
| FITC anti-human CD4 (OKT-4) |
eBioscience |
Cat#50-939-1; RRID: AB_1633390 |
| PE/Cy7 anti-human CD4 (A161A1) |
BioLegend |
Cat#357410; RRID: AB_2565662 |
| APC anti-human CD4 (OKT-4) |
BioLegend |
Cat#317416; RRID: AB_571945 |
| PerCP-Cyanine5.5 anti-human CD4 (RPA-T4) |
eBioscience |
Cat#13557660; RRID: AB_1518744 |
| PE anti-human CD8a (HIT8a) |
eBioscience |
Cat#12-0089-41; RRID: AB_10804878 |
| FITC anti-human CD40 (5C3) |
eBioscience |
Cat#11-0409-41; RRID: AB_1272137 |
| PE anti-human CD154 (CD40L) (24-31) |
BioLegend |
Cat#310806; RRID: AB_314829 |
| FITC anti-human CD80 (2D10.4) |
eBioscience |
Cat#50-967-7; RRID: AB_10853194 |
| PE anti-human CD86 (IT2.2) |
eBioscience |
Cat#12-0869-41; RRID: AB_10804536 |
| BV421 anti-human CD3 (UCHT1) |
BD Biosciences |
Cat#562426; RRID: AB_11152082 |
| PerCP anti-human CD3 (UCHT1) |
BioLegend |
Cat#300428; RRID: AB_893298 |
| Alexa Fluor 700 anti-human CD28 (CD28.2) |
BioLegend |
Cat#302920; RRID: AB_528786 |
| PE anti-human CD28 (CD28.2) |
BioLegend |
Cat#302902; RRID: AB_314304 |
| PE anti-human HLA-DQ (HLADQ1) |
BioLegend |
Cat#318106; RRID: AB_604129 |
| PE anti-human HLA-DR (L243) |
BioLegend |
Cat#307606; RRID: AB_314684 |
| Anti-human HLA-DQ (SPV-L3) |
Abcam |
Cat#ab23632; RRID: AB_447580 |
| Purified anti-human HLA-DR (L243) |
BioLegend |
Cat#307602; RRID: AB_314680 |
| APC/Cy7 anti-human CD27 (O323) |
BioLegend |
Cat#302816; RRID: AB_571977 |
| PE/Cy7 anti-human CD38 (HB-7) |
eBioscience |
Cat#356608; RRID: AB_2561904 |
| InVivoMab anti-human CD3 (OKT-3) |
Bio X Cell |
Cat#BE0001-2; RRID: AB_1107632 |
| InVivoMab anti-human CD28 (9.3) |
Bio X Cell |
Cat#BE0248; RRID: AB_2687729 |
| PE anti-human IL-10 (JES3-9D7) |
eBioscience |
Cat#12-7108-81; RRID: AB_466178 |
| eFluor 450 anti-human IFN-γ (4S.B3) |
eBioscience |
Cat#48-7319-41; RRID: AB_2043867 |
| AffiniPure F(ab’)2 fragment Goat anti-human IgM, Fcsu fragment specific |
Jackson ImmunoResearch |
Cat#109-006-064; RRID: AB_2337548 |
| Bacterial and Virus Strains |
| DH5α competent cells |
Invitrogen |
Cat#18265017 |
| JM109 competent Cells |
Promega |
Cat#L2005 |
| Epstein-Barr Virus B95-8 |
American Type Cell Culture (ATCC) |
Cat#ATCC VR-1492 |
| Biological Samples |
| Human peripheral blood samples |
This paper (Table S1) |
N/A |
| Chemicals, Peptides, and Recombinant Proteins |
| CFSE |
eBioscience |
Cat#65-0850-84 |
| eBioscience Streptavidin PE |
eBioscience |
Cat#12-4317 |
| CpG ODN 2006 (ODN 7909) |
InvivoGen |
Cat#tlrl-2006-1 |
| Nutridoma-SP (basal media) |
Sigma-Aldrich |
Cat#11011375001 |
| Protein A Agarose Beads |
Thermo Fisher Scientific |
Cat#15918014 |
| x-Idiotype peptide (x-Id) (CARQEDTAMVYYFDYW) |
This paper |
N/A |
| Truncated peptide (TP-Id) (ARQEDTAMVYYFDY) |
This paper |
N/A |
| HC peptide (h-Id) (CARQERFWSGPLFDYW) |
This paper |
N/A |
| Insulin peptide (Ins) (SHLVEALYLVCGERG) |
This paper |
N/A |
| Insulin Mimotope peptide (Mim) (SHLVEALYLVCGEEG) |
Crawford et al., 2011 |
N/A |
| Biotinylated-monomers DQB1*03:02/DQA1*03:01 |
NIH Tetramer Core Facility |
N/A |
| Critical Commercial Assays |
| Qiaquick Gel Extraction Kit |
QUIGEN |
Cat#28704 |
| Qiaprep Spin Miniprep Kit |
QUIGEN |
Cat#27106 |
| Qiaprep Plasmid Maxi Kit |
QUIGEN |
Cat#12162 |
| OneStep RT-PCR Kit |
QUIGEN |
Cat#210212 |
| Monarch Total RNA Miniprep Kit |
BioLabs |
Cat#T2010S |
| QIAamp DNA Blood Mini Kit |
QUIGEN |
Cat#51104 |
| RNeasy Mini Kit |
QUIGEN |
Cat#74104 |
| RevertAid First Strand cDNA Synthesis Kit |
QUIGEN |
Cat#K1621 |
| Pierce Protein A Columns |
Pierce |
Cat#20356 |
| EZQ Protein Quantitation Kit |
Invitrogen |
Cat#R33200
|
| Pro-DetectTM Rapid Antibody Isotyping kit, human |
Thermo Fisher Scientific |
Cat#A38552 |
| Deposited Data |
| RNA-seq from DEs, T cells and B cells |
GEO Data Repository |
GEO: GSE129112
|
| Immuno-Seq |
Adaptive Biotechnologies |
10.21417/RA042019 |
| IGH-x |
This paper; GenBank |
MK764540 |
| IGL1-x |
This paper; GenBank |
MK764541 |
| IGL2-x |
This paper; GenBank |
MK764542 |
| TCRA-x |
This paper; GenBank |
MK764543 |
| TCRB-x |
This paper; GenBank |
MK764544 |
| Experimental Models: Cell Lines |
| HEK293A cells |
Thermo Fisher Scientific |
Cat#R705-07 |
| IRR-MRC-5 iRRADIATED Fibroblast |
American Type Cell Culture (ATCC) |
Cat#ATCC 55-X |
| Oligonucleotides |
| GCTGGAGTGGATTGGGAGTA (Forward) Probe1 |
This paper |
N/A |
| CCCAGTAGTCAAAGTAGTAAACCATA (Reverse) Probe1 |
This paper |
N/A |
| GCTGGAGTGGATTGGGAGTA (Forward) Probe2 |
This paper |
N/A |
| TCCCTGGCCCCAGTAGTCAAAGTAGTA (Reverse) Probe2 |
This paper |
N/A |
| RT-PCR and Cloning-PCR primers used for amplification of Heavy and Light chains of single DE cells and x-mAbR
|
Smith et al., 2009 |
N/A |
| RT-PCR and Nested PCR primers used for amplification of TCRα and TCRβ chains of x1.1 DE clone |
Eugster et al., 2013 |
N/A |
| Recombinant DNA |
| AbVec -Igγ, expression vectors |
Smith et al., 2009 |
N/A |
| AbVec –Igλ, expression vectors |
Smith et al., 2009 |
N/A |
| pGEM-T Easy Vector Systems |
Promega |
Cat#A1360 |
| Software and Algorithms |
| FlowJo |
TreeStar |
https://www.flowjo.com/solutions/flowjo |
| GraphPad Prism |
GraphPad Software |
https://www.graphpad.com/scientific-software/prism/ |
| ImmunoSEQ Analyzer 2.0 software |
Adaptive Biotechnologies |
N/A |
| IDEAS6.2 |
MilliporeSigma |
http://www.emdmillipore.com/US/en |
| BASIC: BCR and TCR assembly from single cell RNA-seq |
Toyota Technological Institute at Chicago |
https://ttic.uchicago.edu/~aakhan/BASIC/ |
| IMGT/V-QUEST |
IMGT, the international ImMunoGeneTics information system |
http://www.imgt.org/IMGT_vquest/share/textes/ |
