Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | WASHC4 | GenBank | Gene ID: 23325 | Aka SWIP |
| Gene (Mus musculus) | Washc4 | Ensembl | ENSMUSG00000034560 | |
| Strain, strain background (Mus musculus) | SWIPP1019R | This paper, Duke Transgenic Mouse Facility |
ENSMUSG00000034560 | Mouse line maintained by Soderling lab |
| Strain, strain background (Mus musculus) | B6SJLF1/J | Jackson Laboratories | Cat# 100012 RRID:IMSR_JAX:100012 |
|
| Strain, strain background (Mus musculus) | C57BL/6J | Jackson Laboratories | Cat# 000664 RRID:IMSR_JAX:000664 |
|
| Recombinant DNA reagent | pmCAG-SWIP-WT-HA (plasmid) |
This paper | SWIP-WT | AAV construct to transfect and express the recombinant DNA Sequence |
| Recombinant DNA reagent | pmCAG-SWIP-MUT-HA (plasmid) |
This paper | SWIP-MUT | AAV construct to transfect and express the recombinant DNA Sequence |
| Recombinant DNA reagent | phSyn1-WASH1-BioID2-HA (plasmid) |
This paper | WASH1-BioID2 | Transduced AAV construct Sequence |
| Recombinant DNA reagent | phSyn1- solubleBioID2-HA (plasmid) |
This paper | SolubleBioID2 control | Transduced AAV construct Sequence |
| Recombinant DNA reagent | pAd-DeltaF6 | Addgene | pAd-DeltaF6 | Helper plasmid for AAV2/9 viral preparation Sequence |
| Recombinant DNA reagent | pAAV2/9 | Addgene | pAAV2/9 | Viral capsid Sequence |
| Cell line (Mus musculus) | Primary mouse cortical cultures | This paper | SWIP WT, SWIPP1019RMUT neurons | Freshly isolated from wild-type or SWIPP1019R P0 mouse brains |
| Cell line (Homo sapiens) | Human Embryonic Kidney 293 T cells | Duke Cell Culture Facility | ATTC Cat# CRL-11268 RRID:CVCL_1926 |
|
| Sequence-based reagent | Washc4 CRISPR sgRNA | This paper | Oligonucleotide sequence | N20+ PAM sequence targeting mouse Washc4 gene for introducing C/G mutation 5′ttgagaatactcacaagagg agg3′ |
| Sequence-based reagent | Washc4_F repair | This paper | Forward repair oligonucleotide | Forward strand of the repair oligo used to introduce C/G mutation into mouse Washc4 gene 5′atttcgaaggccaaagaatatacatctccgaaatttctatatcattgttcgtcctcttgtgagtattctcaaaactagaagtgagttattgatgggtgttaatacagattcagtttccataaagca3′ |
| Sequence-based reagent | Washc4_R repair | This paper | Reverse repair oligonucleotide | Reverse strand of the repair oligo used to introduce C/G mutation into mouse Washc4 gene 5′tgctttatggaaactgaatctgtattaacacccatcaataactcacttctagttttgagaatactcacaagaggacgaacaatgatatagaaatttcggagatgtatattctttggccttcgaaat3′ |
| Sequence-based reagent | Washc4_F mutagenesis | This paper | Forward primer |
Washc4 C/G mutagenesis forward primer 5′ctacaaagttgagggtcagacggggaacaattatatagaaa3′ |
| Sequence-based reagent | Washc4_R mutagenesis | This paper | Reverse primer |
Washc4 C/G mutagenesis reverse primer 5′tttctatataattgttccccgtctgaccctcaactttgtag3′ |
| Sequence-based reagent | Washc4_F genotyping | This paper | Forward primer |
Washc4 forward primer for genotyping SWIPP1019R mice 5′tgcttgtagatgtttttcct3′ |
| Sequence-based reagent | Washc4_R genotyping | This paper | Reverse primer |
Washc4 reverse primer for genotyping SWIPP1019R mice 5′gttaacatgatcctatggcg3′ |
| Antibody | Anti-human WASH1 (C-terminal, rabbit monoclonal) | Sigma Aldrich | Cat# SAB42200373 | WB (1:500) |
| Antibody | Anti-human Strumpellin (rabbit polyclonal) | Santa Cruz | Cat# sc-87442 RRID:AB_2234159 |
WB (1:500) |
| Antibody | Anti-human EEA1 (rabbit monoclonal) | Cell Signaling Technology | Clone# C45B10 Cat# 3288 RRID:AB_2096811 |
WB (1:1500) ICC (1:500) |
| Antibody | Anti-human LAMP1 (rabbit monoclonal) | Cell Signaling Technology | Clone# C54H11 Cat# 3243 RRID:AB_2134478 |
WB (1:2000) |
| Antibody | Anti-human Beta Tubulin III (mouse monoclonal) | Sigma Aldrich | Clone# SDL.3D10 Cat# T8660 RRID:AB_477590 |
WB (1:10,000) |
| Antibody | Anti-human HA (mouse monoclonal) | BioLegend | Clone# 16B12 Cat# MMS-101P RRID:AB_10064068 |
WB (1:5000) |
| Antibody | Anti-mouse Cathepsin D (rat monoclonal) | Novus Biologicals | Clone# 204712 Cat# MAB1029 RRID:AB_2292411 |
ICC (1:250) |
| Antibody | Anti-human MAP2 (guinea pig polyclonal) | Synaptic Systems | Cat# 188004 RRID:AB_2138181 |
ICC (1:500) |
| Antibody | Anti-human Cleaved Caspase-3 (rabbit polyclonal) | Cell Signaling Technology | Specificity Asp175 Cat#9661 RRID:AB_2341188 |
IHC (1:2000) |
| Antibody | Anti-human Calbindin (mouse monoclonal) | Sigma Aldrich | Clone# CB-955 Cat# C9848 RRID:AB_476894 |
IHC (1:2000) |
| Antibody | Anti-human HA (rat monoclonal) | Sigma Aldrich | Clone# 3F10 Cat# 11867423001 RRID:AB_390918 |
IHC (1:500) |
| Antibody | Anti-human Bassoon (mouse monoclonal) | Abcam | Clone# SAP7F407 Cat# ab82958 RRID:AB_1860018 |
IHC (1:500) |
| Antibody | Anti-human Homer1 (rabbit polyclonal) |
Synaptic
Systems |
Cat# 160002 RRID:AB_2120990 |
IHC (1:500) |
| Antibody | Anti-human Tyrosine Hydroxylase (chicken polyclonal) | Abcam | Cat# ab76442 RRID:AB_1524535 |
IHC (1:1000) |
| Antibody | Anti-human NeuN (mouse monoclonal) | Abcam | Clone# 1B7 Cat# ab104224 RRID:AB_10711040 |
IHC (1:1000) |
| Commercial assay or kit | TMTpro 16plex Label Reagent | Thermo Fisher | Cat# A44520 | |
| Commercial assay or kit | NeutrAvidin Agarose Resins | Thermo Fisher | Cat# 29201 |
|
| Commercial assay or kit | S-Trap Binding Buffer | Profiti | Cat# K02-micro-10 | |
| Commercial assay or kit | QuikChange XL Site-Directed Mutagenesis Kit | Agilent | Cat# 200517 | |
| Software, algorithm | Courtland et al., source code | GitHub | ||
| Software, algorithm | MSstatsTMT | GitHub | PubMed | |
| Software, algorithm | leidenalg Python Library | conda | Version 0.8.1 | |
| Software, algorithm | Cytoscape | https://cytoscape.org/ | RRID:SCR_003032 | Version 3.7.2 |
| Software, algorithm | Imaris | Oxford Instruments | RRID:SCR_007370 | Version 9.2.0 |
| Software, algorithm | Zen | Zeiss | RRID:SCR_018163 | Version 2.3 |
| Software, algorithm | Fiji | https://fiji.sc/ | RRID:SCR_002285 | Version 2.0.0-rc-69/1.52 p |
| Software, algorithm | GraphPad Prism | GraphPad Software | RRID:SCR_002798 | Version 8.0 |
| Software, algorithm | Proteome Discoverer | Thermo Fisher | RRID:SCR_014477 | Versions 2.2 and 2.4 |
| Software, algorithm | TreadScan NeurodegenScanSuite | CleverSysInc | ||
| Software, algorithm | EthoVision XT | Noldus Information Technology | RRID:SCR_000441 | Version 11.0 |
| Software, algorithm | Rotarod apparatus for mouse | Med Associates | Cat# ENV-575M | |
| Software, algorithm | Fear conditioning chamber | Med Associates | Cat# VFC-008-LP | |
| Software, algorithm | FreezeScan software | CleverSysInc | RRID:SCR_014495 | |
| Software, algorithm | Startle reflex chamber and software | Med Associates | Cat# MED-ASR-PRO1 | |
| Other | Geladaki et al.’s, LOPIT-DC protocol | PubMed | PMCID:PMC6338729 | Subcellular fractionation protocol |
| Other | Orbitrap Fusion Lumos Tribrid Mass Spectrometer | Duke Proteomics and Metabolomics Shared Resource | Mass spectrometer used for spatial proteomics | |
| Other | Thermo QExactive HF-X Mass Spectrometer | Duke Proteomics and Metabolomics Shared Resource | Mass spectrometer used for iBioID | |
| Other | Zeiss 710 LSM confocal microscope | Duke Light Microscopy Core Facility (LCMF) | RRID:SCR_018063 | Confocal microscope used for image acquisition of ICC and IHC samples |
| Other | Reichert Ultracut E Microtome | Duke Department of Pathology | Microtome used to prepare TEM samples | |
| Other | Phillips CM12 Electron Microscope | Duke Department of Pathology | Transmission electron microscope used for TEM image acquisition | |
| Other | Beckman XL-90 Centrifuge and Ti-70 rotor | Duke Department of Cell Biology | Ultracentrifuge used for AAV virus preparation | |
| Other | Beckman TLA-100 Ultracentrifuge and TLA-55 rotor | Duke Department of Cell Biology | Ultracentrifuge used for spatial proteomics sample preparation | |
| Other | DAPI stain | Thermo Fisher | Cat# D1306 RRID:AB_2629482 |
(1 µg/mL) |