TABLE 2.

Variants identified of neurofibromatosis in this study.

Nucleotide change	Mutation gene	Amino acid change	Variant type	Type of variants	Reference	Inheritance	SIFT_score	Mutation Taster_score
c.5072_5073insTATAACTGTAACT CCTGGGTCAGGGAGTACACCAA	NF1	p.Tyr1692Ilefs	Frameshift	Germline	Novel	Familial	0	0
c.4110 + 1G > T	NF1	NA	Splicing	Germline	Reported	Sporadic	0	1
c.3826C > T	NF1	p.Arg1276Ter	Missense	Germline	Reported	Sporadic	1	1
c.495_498del	NF1	p.Thr165fs	Frameshift	Mosaicism	Reported	Sporadic	0	0
c.36_39del	NF2	p.Ser12fs	Frameshift	Germline	Reported	Sporadic	0	0

NA, not available.