Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus C57Bl/6J female) | C57Bl/6 | The Jackson Laboratory | RRID:IMSR_JAX:000664 | Bred and housed in individually ventilated cages (SPF conditions) at the University of Edinburgh |
| Strain, strain background (Plasmodium
chabaudi chabaudi AS) |
P. chabaudi AS | The European malaria reagent repository http://www.malariaresearch.eu | Clone 28AS11 | |
| Strain, strain background (Plasmodium chabaudi chabaudi AJ) | P. chabaudi AJ | Clone 96AJ15 | ||
| Strain, strain background (Anopheles stephensi SD500) | Mosquitoes | Reared in-house at the University of Edinburgh | ||
| Antibody | Anti-mouse B220 (rat monoclonal) |
Clone RA3-6B2 eBioscience - sold by ThermoFisher |
RRID:AB_10717389 | (0.2 μl) per test = 2 million cells in 100 μl volume |
| Antibody | Anti-mouse CD3ε (Armenian hamster monoclonal) |
Clone 145–2 C11 BioLegend |
RRID:AB_312676 | (0.3 μl) per test |
| Antibody | Anti-mouse CD4 (rat monoclonal) |
Clone RM4-5 BioLegend |
RRID:AB_312718 | (0.3 μl) per test |
| Antibody | Anti-mouse CD8a (rat monoclonal) |
Clone 53–6.7 BioLegend |
RRID:AB_312750 | (0.3 μl) per test |
| Antibody | Anti-mouse CD11b (rat monoclonal) |
Clone M1/70 BioLegend |
RRID:AB_312798 | (0.1 μl) per test |
| Antibody | Anti-mouse CD11c (Armenian hamster monoclonal) |
Clone N418 BioLegend |
RRID:AB_313776 | (0.15 μl) per test |
| Antibody | Anti-mouse CD16/32 (rat monoclonal) |
Clone 93 eBioscience - sold by ThermoFisher |
RRID:AB_469598 | (0.5 μl) per test |
| Antibody | TruStain FcX anti-mouse CD16/32 (rat monoclonal) |
Clone 93 BioLegend |
RRID:AB_1574973 | (2 μl) per test blocks FcɣR II/III prior to antibody staining |
| Antibody | Anti-mouse CD19 (rat monoclonal) |
Clone 6D5 BioLegend |
RRID:AB_313646 | (0.1 μl) per test |
| Antibody | Anti-mouse CD27 (Armenian hamster monoclonal) | Clone LG.7F9 eBioscience - sold by ThermoFisher |
RRID:AB_465614 | (0.3 μl) per test |
| Antibody | Anti-mouse CD34 (rat monoclonal) |
Clone RAM34 eBioscience - sold by ThermoFisher |
RRID:AB_465021 | (0.4 μl) per test |
| Antibody | Anti-mouse CD71 (rat monoclonal) |
Clone RI7217 BioLegend |
RRID:AB_10899739 | (0.3 μl) per test |
| Antibody | Anti-mouse CD115/Csf1r (rat monoclonal) |
Clone AFS98 BioLegend |
RRID:AB_2562760 | (0.3 μl) per test |
| Antibody | Anti-mouse CD135/Flt3 (rat monoclonal) |
Clone A2F10 eBioscience - sold by ThermoFisher |
RRID:AB_465859 | (2.5 μl) per test |
| Antibody | Anti-mouse CD169 (rat monoclonal) |
Clone 3D6.112 BioLegend |
RRID:AB_2563910 | (1 μl) per test |
| Antibody | Anti-mouse cKit/CD117 (rat monoclonal) |
Clone 2B8 eBioscience - sold by ThermoFisher |
RRID:AB_1834421 | (0.3 μl) per test |
| Antibody | Anti-mouse CX3CR1 (mouse monoclonal) |
Clone SA011F11 BioLegend |
RRID:AB_2564493 | (0.3 μl) per test |
| Antibody | Anti-mouse F4/80 (rat monoclonal) |
Clone BM8 BioLegend |
RRID:AB_10901171 | (0.8 μl) per test |
| Antibody | Anti-mouse IAb (mouse monoclonal) |
Clone AF6-120.1 BioLegend |
RRID:AB_313724 | (0.5 μl) per test |
| Antibody | Anti-mouse Ly6C (rat monoclonal) |
Clone HK1.4 BioLegend |
RRID:AB_2562177 | (0.1 μl) per test |
| Antibody | Anti-mouse Ly6G (rat monoclonal) |
Clone 1A8-Ly6g eBioscience - sold by ThermoFisher | RRID:AB_2573893 | (0.2 μl) per test |
| Antibody | Anti-mouse NK1.1 (mouse monoclonal) |
Clone PK136 BioLegend |
RRID:AB_313396 | (0.3 μl) per test |
| Antibody | Anti-mouse Nr4a1/Nur77 (mouse monoclonal) |
Clone 12.14 eBioscience - sold by ThermoFisher |
RRID:AB_1257209 | (0.3 μl) per test intracellular stain |
| Antibody | Anti-mouse Sca1/Ly6a (rat monoclonal) |
Clone D7 BioLegend |
RRID:AB_2562275 | (2 μl) per test |
| Antibody | Anti-mouse Ter119 (rat monoclonal) |
Clone Ter119 BioLegend |
RRID:AB_313712 | (0.3 μl) per test |
| Antibody | Anti-mouse VCAM-1 (rat monoclonal) |
Clone 429 BioLegend |
RRID:AB_1595594 | (0.5 μl) per test |
| Antibody | Anti-H3K27ac ChIPseq grade (rabbit polyclonal) |
Diagenode #C15410196 see our optimised ChIPseq protocol dx.doi.org/10.17504/protocols.io.bja3kign |
RRID:AB_2637079 | (2 μg) per ChIP |
| Antibody | Anti-H3K4me1 ChIPseq grade (rabbit polyclonal) |
Diagenode #C15410037 see our optimised ChIPseq protocol dx.doi.org/10.17504/protocols.io.bja3kign |
RRID:AB_2561054 | (5 μg) per ChIP |
| Antibody | Anti-H3K9me3 ChIPseq grade (rabbit polyclonal) |
Diagenode #C15410193 see our optimised ChIPseq protocol dx.doi.org/10.17504/protocols.io.bja3kign |
RRID:AB_2616044 | (1 μg) per ChIP |
| Sequence-based reagent | Forward primer | 5-GCGAGAAAGTTAAAAGAATTGA-3 | For measuring P. chabaudi blood-stage parasitaemia by quantitative PCR | |
| Sequence-based reagent | Reverse primer | 5-CTAGTGAGTTTCCCCGTGTT-3 | ||
| Sequence-based reagent | Probe | [6FAM] - AAATTAAGCCGCAAGCTCCACG - [TAM] | ||
| Commercial assay or kit | Quick DNA Universal Microprep Kit | Zymo Research | D4074 | |
| Commercial assay or kit | IFNɣ mouse ELISA kit, extra sensitive | Invitrogen - sold by ThermoFisher | BMS609 | |
| Commercial assay or kit | IP-10 (CXCL10) mouse ELISA kit | Invitrogen - sold by ThermoFisher | BMS6018 | |
| Commercial assay or kit | Mouse/rat Angiopoietin-2 quantine ELISA kit | R&D Systems | MANG20 | |
| Commercial assay or kit | Foxp3 / Transcription Factor Staining Buffer Set | eBioscience - sold by ThermoFisher | 00-5523-00 | |
| Commercial assay or kit | SMART-Seq v4 Ultra Low Input RNA Kit | Takara Bio | 634891 | |
| Commercial assay or kit | Nextera XT DNA Library Preparation Kit | Illumina | FC-131-1024 | |
| Commercial assay or kit | True MicroChIP kit | Diagenode | C01010130 | |
| Commercial assay or kit | MicroPlex Library Preparation Kit v2 | Diagenode | C05010012 | |
| Commercial assay or kit | RNA Clean and Concentrator-5 Kit | Zymo Research | R1013 | |
| Commercial assay or kit | GeneChip WT Pico Kit | Affymetrix - sold by ThermoFisher | 902622 | |
| Commercial assay or kit | GeneChip Mouse Gene 1.0 ST Array | Affymetrix - sold by ThermoFisher | 901168 | |
| Chemical compound, drug | 4-Aminobenzoic acid | Sigma-Aldrich | A9878 | |
| Chemical compound, drug | Chloroquine diphosphate salt | Sigma-Aldrich | C6628 | Dissolve in water, dosage: 100 mg/kg by oral gavage |
| Chemical compound, drug | Lipopolysaccharide from Escherichia coli 0111:B4 | Sigma-Aldrich | L4391 | |
| Software, algorithm | bowtie2 v2.2.7 | (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
RRID:SCR_016368 | |
| Software, algorithm | DESeq2 | (Love et al., 2014) https://bioconductor.org/packages/release/bioc/html/DESeq2.html | RRID:SCR_015687 | |
| Software, algorithm | Cytoscape v3.8.0 | (Shannon et al., 2003) https://cytoscape.org/ | RRID:SCR_003032 | |
| Software, algorithm | clueGO v2.5.4 | (Bindea et al., 2009; Mlecnik et al., 2014) http://apps.cytoscape.org/apps/cluego | RRID:SCR_005748 | |
| Software, algorithm | HOMER v4.10 | (Heinz et al., 2010) http://homer.ucsd.edu/ | RRID:SCR_010881 | |
| Software, algorithm | Integrative genomics viewer (IGV) | (Thorvaldsdóttir et al., 2013) http://www.broadinstitute.org/igv/ | RRID:SCR_011793 |