Abstract
Leuconostoc citreum, a type of food-grade probiotic bacteria, plays an important role in food fermentation and intestinal probiotics. Biofilms help bacteria survive under adverse conditions, and LuxS/AI-2-dependent quorum sensing (QS) plays an important role in the regulation of their biofilm-forming activities. L. citreum 37 was a biofilm-forming strain isolated from dairy products. The aim of this study was to analyze genes involved in the LuxS/AI-2 system based on genome sequencing and biofilm formation of L. citreum 37. Genome assembly yielded two contigs (one chromosome and one plasmid), and the complete genome contained 1,946,279 base pairs (bps) with a G + C content of 38.91%. The genome sequence analysis showed that there were several pathways such as the two-component system, QS, and seven other signal pathways, and 26 genes (including luxS, pfs, and 24 other genes) may participate in QS related to biofilm formation. All these results showed that the LuxS/AI-2 system is complete in the genome of L. citreum 37. The quantitative polymerase chain reaction (qPCR) of pfs, luxS genes, and AI-2 production of L. citreum 37 in planktonic state and biofilm state showed that the expression of pfs and luxS genes was consistent with the production of AI-2 and was positively correlated with biofilm formation. After luxS of L. citreum 37 expressed in Escherichia coli BL21, AI-2 production was detected, suggesting that the luxS gene played an important role in AI-2 synthesis, Therefore, luxS may regulate the biofilm formation of L. citreum 37 by participating in AI-2 synthesis. It is projected that results of this study could help facilitate further understanding and application of L. citreum 37.
Supplementary Information
The online version contains supplementary material available at 10.1007/s13205-021-02747-2.
Keywords: Leuconostoc citreum, Biofilm, Quorum sensing, LuxS/AI-2, Complete genome sequencing
Introduction
The genus Leuconostoc consists of 24 different species (Sharma et al. 2018), which include L. citreum, a Gram-positive, non-spore-forming heterofermentative lactic acid bacterium (LAB). L. citreum plays a significant role in the fermentation of many foods from the initial to the middle stage of fermentation. During fermentation stages, the bacterium produces various metabolites contributing to the flavor of fermented foods. As reported in various studies, L. citreum was effective in the fermentation of milk, vegetable, meat, and wine, especially kimchi and sauerkraut (Jang et al. 2018; Wright et al. 2017; Kim et al. 2018). L. citreum 37 was isolated from Mongolian yogurts produced using the traditional process in Inner Mongolia. In our previous study, we showed its fermentation characteristics, exopolysaccharide-producing capability (Zhang et al. 2014), and preferred biofilm-forming specialty (Chen et al. 2017).
It has been shown that the biofilm formation process is regulated by the bacteria quorum sensing (QS) pathway (Sun et al. 2014; Song et al. 2019). QS is a mechanism for regulation of gene expression in response to the density of a bacterial population. There are three types of bacterial QS system. Among them, the LuxS/AI-2 system exists widely in both Gram-negative and Gram-positive bacteria.
In the LuxS/AI-2 system, AI-2 is, therefore, often called an interspecies signaling molecule. Some pathogens, including Vibrio spp. and Salmonella, use AI-2 as a cue to sense population density (Christiaen et al. 2014). AI-2 is identified as a furanosyl borate diester, and the AI-2 biosynthetic pathway has been determined in some bacteria. AI-2 is produced from S-adenosylmethionine (SAM) in three enzymatic steps (Fig. 1). In detail, the consumption of SAM as a methyl donor produces S-adenosylhomocysteine (SAH). The adenine base of SAH is removed by a nucleosidase (pfs) to produce S-ribosyl homocysteine (SRH), under the action of luxS enzyme, SRH is converted into homocysteine and 4,5-dihydroxy-2,3-pentanedione (DPD). AI-2 is a group of interconvertible molecules formed by spontaneous cyclization of DPD (Niu et al. 2012; Han and Lu 2009b).
Fig. 1.
Metabolic pathways found in bacteria that lead to synthesis of AI-2
Many studies have shown that LuxS/AI-2 regulates the formation of biofilms and increases their virulence. For example, the LuxS/AI-2-dependent QS system in Haemophilus parasuis not only plays an important role in growth and biofilm formation, but also affects its pathogenicity (Zhang et al. 2019). Vidal et al. (2011) have demonstrated that the LuxS-controlled QS system in Streptococcus pneumoniae regulates early biofilm formation. Biofilm structures might be important for S. pneumoniae strains’ ability to persist and possibly cause important diseases such as otitis media or pneumonia.
Recently, there has been growing research interest in the biofilm formation and QS system of probiotics. According to different reports, probiotics can increase their viability and intestinal colonization by LuxS/AI-2. Jia et al. (2018) indicated that the luxS gene was closely involved in certain probiotic properties of Lactobacillus plantarum KLDS1.0391, such as stress tolerance and adhesion abilities. Sun et al. (2014) demonstrated that all bifidobacteria harbor LuxS homologues, which are functional in all strains tested and result in the production of AI-2-like molecules. Moreover, the AI-2-like signal in the supernatant played a role in the formation of biofilms. Liu et al. (2018) found that over expression of the luxS gene in Lactobacillus paraplantarum L-ZS9 increased the production of AI-2. At the same time, over expression of luxS promoted heat and bile salt resistance, and biofilm formation of the strain. On the other hand, probiotics could regulate the LuxS/AI-2 QS pathway of pathogenic bacteria to reduce their biofilm formation and virulence. Song et al. (2019) demonstrated that Lactobacillus rhamnosus GG can inhibit the biofilm formation of Escherichia coli by decreasing its luxS gene expression.
However, there are still many areas that warrant in-depth research about biofilm formation and QS system of probiotics. Our previous study had found that there was luxS gene expression in L. citreum 37, and the isolate strain could form better biofilms. The aim of this study was to explore the integrity of LuxS/AI-2-dependent QS in L. citreum 37 based on complete genome sequencing. And the luxS from L. citreum 37 was expressed in E. coli BL21 based on heterologous expression to explore the key genes for the synthesis of signal molecule AI-2. The stress-tolerant biofilm-forming LAB not only can be a food-grade microbial cell factory, such as food fermentation, but can also inhibit pathogenic bacteria virulence.
Materials and methods
Bacterial strains and culture conditions
Leuconostoc citreum 37 was incubated aerobically at 37 °C in de Man–Rogosa–Sharpe (MRS) broth (Land Bridge Technology, Beijing, China) and MRS agar. E. coli BL21 (TANGA, China) was incubated in Lennox broth or on solid medium with 1.8% (w/v) agar at 37 °C. Vibrio harveyi BB170 (ATCCBAA-1117) was incubated aerobically at 28 °C in AB broth (Land Bridge Technology) and AB agar. E. coli BL21 with pET28a vector was cultured in Lennox broth with 50 µg/mL Kanamycin.
Functional annotation of genome of L. citreum 37
Genomic DNA was extracted from L. citreum 37 using a TINAamp Bacteria DNA Kit (TIANGENE, Beijing, China), and the quantity and purity were determined using a NanoDrop2000C Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). The genome of L. citreum 37 was sequenced on the single molecule real-time (SMRT) DNA sequencing platform by a PacBio RS II sequencer. PacBio 20 kb SMRTbell libraries were generated and were loaded to SMRT cells for sequencing. The circular genomic map was constructed by the CGView Server. Putative protein-coding sequences (CDS) were identified using the Glimmer system (Xiong et al. 2019). Functional annotation of CDS was performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (http://www.genome.jp/kegg) and the Clusters of Orthologous Groups of proteins (GOG) database (https://www.ncbi.nlm.nih.gov/GO/).
Biofilm bioassay
The planktonic L. citreum 37 was cultured shakily in MRS broth at 200 rpm for 24 h, and L. citreum 37 in the biofilm state was incubated in 96-well plates (JET BIOFIL, Guangzhou, China). The method used for assaying biofilm formation of L. citreum 37 was based on a previously described process (Lebeer et al. 2007) with minor modifications. Briefly, the device used for biofilm formation is a platform carrying 96 polystyrene pegs that fits as a microtiter plate lid with a peg hanging into each microtiter plate well. For biofilm formation, the device was placed in its original sterile tray filled with 200 µL medium. Then, L. citreum 37 (3.6 × 107 CFU) was added in pegs and incubated without shaking for 24 h at 37 °C to obtain biofilm state L. citreum 37. For planktonic L. citreum 37 biofilm formation, the 96 polystyrene pegs were placed in its original sterile tray filled with 200 µL medium. L. citreum 37 (3.6 × 107 CFU) was added and incubated with shaking for 24 h at 37 °C. To quantify biofilm formation, the pegs were briefly washed in phosphate-buffered saline (PBS). The remaining attached bacteria were stained for 30 min with 200 µL 0.1% crystal violet, rinsed with distilled water and air-dried. One hundred microliters of 95% ethanol were added to each well to dissolve the crystal violet. The optical density at 595 nm was determined using a Synergy 2 microplate reader (Thermo Fisher Scientific).
AI-2 bioassay
Biofilm state L. citreum 37 and planktonic state L. citreum 37 were cultured in 10% (w/v) skim milk medium for 24 h. Cells were centrifuged at 12,000 rpm at 4 °C for 15 min. The cell-free culture fluid (CF) was obtained by filtering the supernatant through a 0.22-µm filter (JET BIOFIL). The reporter strain V. harveyi BB170 was diluted 1:5000 in AB medium, and the CF sample was added to the diluted BB170 culture at 1:100 (v/v). The mixture was incubated at 28 °C for 5 h. Next, 100 µL aliquots were added to black, flat-bottomed, 96-well plates (JET BIOFIL) to detect AI-2 production. The method used for assaying AI-2 formation of L. citreum 37 was based on a previously described process (Liu et al. 2018; Turovskiy and Chikindas 2006). The CFs from V. harveyi BB170 and E. coli BL21 were used as the positive and negative control, respectively. Luminescence values were measured with a Thermo Scientific Varioskan LUX in luminescence mode (Thermo Fisher Scientific).
Quantitative real-time polymerase chain reaction
The planktonic L. citreum 37 was incubated in 96-well plates (JET BIOFIL) and cultured shakily in MRS broth at 200 rpm for 24 h, and biofilm state L. citreum 37 was also incubated in 96-well plates (JET BIOFIL). The medium was removed and washed three times with PBS to remove the broth (Song et al. 2019). L. citreum 37 was collected by centrifugation for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. Total RNA was extracted with RNAiso Plus reagent (TaKaRa, Shiga, Japan) according to the manufacturer’s recommendation. Then, cDNA was synthesized using PrimeScript RT Master Mix (Takara) according to the manufacturer’s instructions. qRT-PCR amplifications were performed with at least three biological replicates using 29 SYBR Premix Ex TaqTM II (DRR081A; Takara) with a LightCycler4 80 (Roche Diagnostics, Rotkreuz, Switzerland). The housekeeping gene 16S ribosomal RNA (rRNA) was used as control for normalization. The specific primers used for the various RT-PCR assays are listed in Table 1.
Table 1.
Primers used in qPCR
| Primer | Sequence (5′–3′) |
|---|---|
| luxS-F | GGCTTAGTGCGTGATGAAATTGATGG |
| luxS-R | CCAAGAAATGACATGAAACCCAGTACG |
| pfs-F | GTCACTGTCTTCGGCTATGATTTCG |
| pfs-R | GTCACTGTCTTCGGCTATGATTTCG |
| 16S-F | TACCGCATAACAACTTGGACC |
| 16S-R | GCCGAAGGCTTTCACATCA |
luxS of L. citreum 37 expressed in Escherichia coli BL21
In the complete genome sequence of L. citreum 37, we detected two genes, luxS and pfs, encoding a LuxS-like protein and pfs protein, respectively (Song et al. 2019; Han and Lu 2009a). The pfs and LuxS genes were amplified from genomic DNA by PCR using oligonucleotides pfs-F and pfs-R, and LuxS-F and LuxS-R (Table 2), respectively. The primers generated a HindIII site and a BamHI site (underlined) that were used to clone the HindIII/BamHI-digested PCR fragments into HindIII/BamHI-digested pET28a. BL21 (Song et al. 2018; Han and Lu 2009a, b) were transformed with expression vectors luxS-pET28a and pfs-pET28a, respectively, and grown on Luria–Bertani (LB) agar plates (1% tryptone, 0.5% yeast extract, 1% NaCl, and 1.5% agar) containing Kan (50 µg/mL). The complement vector was verified by PCR and sequencing.
Table 2.
Oligonucleotide primers used in PCR
| Name | Oligonucleotide sequence (5′–3′) | Target gene |
|---|---|---|
| luxS-F | CCAAGCTTATGTCAGAAACAGTTG | luxS |
| luxS-R | CGGGATCCTTATACAACATGACGTTCGAACGC | luxS |
| pfs-F | CAAGCTTATGAAAATCGGCATTATCACGC | pfs |
| pfs-R | CGGATCCTTACGCTTTATTATCAAGA | pfs |
The AI-2 production of luxS-pET28a-BL21 and pfs-pET28a-BL21 strains, and the pET28a-BL21 were detected using the method described in “AI-2 bioassay”.
Results and discussion
Genome features of L. citreum 37
The specific features of L. citreum 37 genome are summarized in Table 3. This strain had one circular chromosome of 1,946,279 bp and had a circular plasmid of 36,191 bp (Fig. 2a, b) and G + C contents of 38.91%. There are 1918 coding genes, 12 rRNA operons, and 70 transfer RNAs (tRNAs) harbored on the chromosome, and 36 coding genes on the plasmid (Fig. 2b). The eggNOG-mapper software (Martinez-Urtaza et al. 2017) was used to annotate the eggNOG of protein-coding genes. A total of 1649 genes were annotated, including energy production and conversion, amino acid transport and metabolism, replication, recombination and repair, cell wall/membrane/envelope biogenesis, and signal transduction mechanisms (Table 4). According to the KEGG and Swiss-prot analysis, there may be 26 genes involved in biofilm or QS regulation. The details are shown in Table 5. In this work, we focused on luxS and pfs genes.
Table 3.
Genome features of Leuconostoc citreum strain 37
| Seq ID | Item | Description |
|---|---|---|
| Genome size | 1,946,279 | |
| GC content % | 38.91% | |
| Protein coning genes | 1918 | |
| tRNAs | 70 | |
| 37-chr | rRNAs | 12 |
| LuxS gene length | 477 bp | |
| pfs gene length | 675 bp | |
| Genome size | 36,191 | |
| GC content % | 40.54 | |
| 37-plasmid | Protein coding genes | 36 |
| rRNA | 0 | |
| tRNA | 0 | |
| Other ncRNAs | 1 |
rRNA ribosomal RNA, tRNA transfer RNA, ncRNA noncoding RNA
Fig. 2.
a Graphical maps of Leuconostoc citreum strain 37 chromosome. From the center to the outside: first circle represents scale; circle 2 represents GC skew; circle 3 represents GC content. The fourth and seventh circles represent the COG to which each CDS belongs. The fifth and sixth circles represent CDS, tRNA, and rRNA positions on the genome. b Graphical maps of plasmid of L. citreum strain 37. c Kyoto Encyclopedia of Genes and Genomes (KEGG) annotation
Table 4.
eggNOG statistics on classified annotation results
| COG categories | Categories function | ORF number | % |
|---|---|---|---|
| A | RNA processing and modification | 0 | 0 |
| B | Chromatin structure and dynamics | 0 | 0 |
| C | Energy production and conversion | 74 | 4.49 |
| D | Cell cycle control, cell division, chromosome partitioning | 19 | 1.15 |
| E | Amino acid transport and metabolism | 121 | 7.34 |
| F | Nucleotide transport and metabolism | 75 | 4.55 |
| G | Carbohydrate transport and metabolism | 131 | 7.94 |
| H | Coenzyme transport and metabolism | 52 | 3.15 |
| I | Lipid transport and metabolism | 44 | 2.67 |
| J | Translation, ribosomal structure and biogenesis | 139 | 8.43 |
| K | Transcription | 130 | 7.88 |
| L | Replication, recombination and repair | 128 | 7.76 |
| M | Cell wall/membrane/envelope biogenesis | 101 | 6.12 |
| N | Cell motility | 0 | 0 |
| O | Post-translational modification, protein turnover, chaperones | 52 | 3.15 |
| P | Inorganic ion transport and metabolism | 81 | 4.91 |
| Q | Secondary metabolites biosynthesis, transport and catabolism | 11 | 0.67 |
| R | General function prediction only | 0 | 0 |
| S | Function unknown | 392 | 23.77 |
| T | Signal transduction mechanisms | 40 | 2.43 |
| U | Intracellular trafficking, secretion, and vesicular transport | 22 | 1.33 |
| V | Defense mechanisms | 37 | 2.24 |
| W | Extracellular structures | 0 | 0 |
| Y | Nuclear structure | 0 | 0 |
| Z | Cytoskeleton | 0 | 0 |
COG Clusters of Orthologous Groups of proteins, ORF open reading frame
Table 5.
Prediction of gene function involved in QS or biofilm formation
| No. | Gene name | Location | KEGG | Swiss-Prot |
|---|---|---|---|---|
| 1 | CiaH | chr_1680 |
ko02020, ko02024 |
Sensor protein CiaH |
| 2 | CiaR | chr_1681 |
ko02020, ko02024 |
Transcriptional regulatory protein CiaR |
| 3 |
AgrC (agrC, blpH, fsrC) |
chr_32 |
ko02020, ko02024 |
|
| 4 |
AgrA (agrA, blpR, fsrA) |
chr_33 |
ko02020, ko02024 |
Accessory gene regulator protein A |
| 5 | luxS | chr_1671 |
ko02024, ko02026, ko05111, ko00270 |
S-ribosylhomocysteine lyase |
| 6 | Transporter (livK) | chr_568 |
ko02024, ko02010 |
Leucine-specific-binding protein |
| 7 | Pel | chr_1084 |
ko02024, ko00040 |
Pectate lyase |
| 8 | ToxE (ribD) | chr_915 | ko02024 | Riboflavin biosynthesis protein RibD |
| 9 | ToxF (TC.BAT2) | chr_1088 | ko02024 | |
| 10 |
OppA (OppA, mppA) |
chr_151 |
ko02024, ko02010 |
Oligopeptide-binding protein OppA |
| 11 |
CcfA (yidC, spoIIIJ) |
chr_425 chr_1914 |
ko02024, ko03060, ko03070 |
Membrane protein insertase YidC 1 |
| 12 | cysE | chr_1021 |
ko05111, ko0270 |
Serine acetyltransferase |
| 13 | LivH | chr_569 |
ko02024, ko02010 |
Chain amino acid transport system permease protein LivH |
| 14 | LivM | chr_570 |
ko02024, ko02010 |
Chain amino acid transport system permease protein BraE |
| 15 | LivG | chr_571 |
ko02024, ko02010 |
Binding protein BraF |
| 16 | LivF | chr_572 |
ko02024, ko02010 |
Binding protein LivF |
| 17 | OppB | chr_152 |
ko02024, ko02010 |
Oligopeptide transport system permease protein OppB |
| 18 | OppC | chr_153 |
ko02024, ko02010 |
Dipeptide transport system permease protein DppC |
| 19 | OppD | chr_154 |
ko02024, ko02010 |
Oligopeptide transport ATP-binding protein OppD |
| 20 | OppF | chr_155 |
ko02024, ko02010 |
Oligopeptide transport ATP-binding protein OppF |
| 21 | SecY | chr_1770 |
ko03060, ko03070, ko02024 |
Protein translocase subunit SecY |
| 22 | SecG | chr_427 |
ko03060, ko03070, ko02024 |
Probable protein-export membrane protein SecG |
| 23 | YajC | chr_390 |
ko03060, ko03070, ko02024 |
Sec translocon accessory complex subunit YajC |
| 24 |
Ffh (SRP54, ffh) |
chr_1478 |
ko03060, ko03070, ko02024 |
Signal recognition particle protein |
| 25 | FtsY | chr_1480 |
ko03060, ko03070, ko02024 |
Signal recognition particle receptor FtsY |
| 26 | SecA | chr_1802 |
ko03060, ko03070, ko02024 |
Protein translocase subunit SecA |
Homologous comparison by Basic Local Alignment Search Tool revealed 1403 CDS sequences comprising 75 functional GO (http://www.ncbi.nim.nih.gov/GO/) and a portion of the 1049 CDS that included 40 KEGG metabolic pathways (Fig. 2c). Of the coding sequences, the five most abundant groups in the category of biological process were about the molecular function, cellular nitrogen compound metabolic process, as well as cell and biosynthetic process, thus suggesting that proteins involved in biological process are responsible for maintaining the higher metabolic activity of this bacterial species. In contrast, few genes were annotated in several other subgroups, including cell–cell signaling, circulatory system process, and cell proliferation, implying that fewer proteins encoded by this species would participate in such biological processes. The final genome sequence was deposited at the National Center for Biotechnology Information database (CP063830–CP063831).
Analysis of QS LuxS/AI-2 system based on genome sequencing
According to the functional annotation (KEGG, GO, Swiss-Prot) of the encoded genes, 26 genes properly involved in QS or biofilm formation of L. citreum 37 were analyzed (Table 5).
Complete genome analysis and electrophoretic mapping showed that L. citreum 37 contains all the genes involved in AI-2 production, including MetK, DNMT/dcm, pfs, luxS, and mmuM/BHMT2 (Supplementary Fig. 1). As shown in Fig. 3, their synthetic process of AI-2 was deduced. Specifically, MetE/MetH is responsible for transforming homocysteine into methionine. Methionine is then converted to SAM in a reaction catalyzed by MetK. Methyltransferase transforms SAM to SAH, which is converted into homocysteine through pfs and LuxS, and AI-2 is produced. Although the AI-2 synthesis pathway of L. citreum 37 was basically the same as that of L. paraplantarum L-ZS9, the genes involved were different (Liu et al. 2017). Moreover, the sizes of these five genes were consistent with their sequencing results. These results suggested that the LuxS/AI-2 pathway has integrity in L. citreum 37.
Fig. 3.
The estimated AI-2 production pathway in L. citreum 37. MetE/MetH is responsible for transforming homocysteine into methionine. Methionine is then converted to S-adenosylmethionine (SAM) in a reaction catalyzed by MetK. Methyltransferase transforms SAM to SAH, which is converted to homocysteine through pfs and LuxS, and AI-2 is produced
Biofilm regulation of QS genes
AI-2 production of planktonic and biofilm state L. citreum 37
We used a reporter strain to detect the AI-2 production to verify the QS-synthesizing activity of L. citreum 37 in the planktonic and biofilm states (Song et al. 2019). As shown in Fig. 4a, the AI-2 production of the biofilm state strain, whose luminous intensity was 1306 ± 20 RLU, was significantly increased compared with the planktonic strain, whose luminous intensity was 1090 ± 18 RLU (p < 0.05). These results indicated that the AI-2 activity level was higher in the biofilm state strain than in the planktonic strain.
Fig. 4.
AI-2 activity in cell-free culture fluids A, biofilm formation B, and mRNA expression of Leuconostoc citreum 37 in planktonic and biofilm states. Data are presented as mean ± standard error of the mean (SEM). n ≥ 3. *p ≤ 0.05, **p ≤ 0.01
Biofilm formation of planktonic and biofilm state L. citreum 37
The biomass of biofilms of L. citreum 37 in the planktonic and biofilm states was evaluated using crystal violet staining. The pictures of the crystal violet staining is shown in Supplementary Fig. 2. Crystal violet staining results showed that biofilm state L. citreum 37 formed greater biofilm biomasses than the planktonic one (Fig. 4b), which was consistent with the AI-2 activity results, indicating that the LuxS/AI-2 QS system was regulating the biofilm formation.
mRNA expression of planktonic and biofilm state L. citreum 37
To further confirm the relationship between LuxS/AI-2 QS system and biofilm formation, pfs and luxS gene expression was validated in planktonic and biofilm state L. citreum 37. qRT-PCR was performed to analyze the relative mRNA level of pfs and luxS. As shown in Fig. 4c, luxS and pfs mRNA expression in cells in biofilm state was up-regulated compared with that in planktonic state cells (p < 0.05). These changes were in accordance with AI-2 activity and biofilm formation in these two types of cells.
According to reports, when exogenous AI-2 is added to cultures of Streptococcus mutans, the biofilms of S. mutans possessed a greater biomass (Wang et al. 2017). The same was observed in L. citreum 37, in that AI-2 production increased with enhanced luxS and pfs mRNA expression and biofilm formation increased. The improving production of AI-2 promoted the thickness of biofilm and the growth of L. citreum 37. These results suggested that the L. citreum 37 biofilm was related to the luxS and pfs QS system.
LuxS of L. citreum 37 expressed in Escherichia coli BL21 promotes AI-2 production
To confirm that luxS or pfs gene expression could promote AI-2 production, LuxS and pfs of L. citreum 37 expressed in Escherichia coli BL21. Strains luxS-pET28a-BL21 and pfs-pET28a-BL21 were constructed from the parent strain L. citreum 37 and identified by PCR (Supplementary Fig. 3). The recombinant strains of the luxS gene, validated double enzyme digestion (Supplementary Fig. 4) and confirmed by the genetic sequencing.
The luxS gene encodes an enzyme involved in the metabolism of SRH, eventually leading to the production of AI-2 (Liu et al. 2017). The AI-2 production of luxS-pET28a-BL21, pfs-pET28a-BL21, and pET28a-BL21 was measured after cultured with 1 mM IPTG. As shown in Fig. 5, the strain BL21 and pET28a-BL21 had no difference in the AI-2 yield, meaning the empty plasmid pET28a had no influence on AI-2 production. The AI-2 production of luxS-pET28a-BL21, whose luminous intensity was 1841 ± 27 RLU, was significantly higher than that of pfs-pET28a-BL21, whose luminous intensity was 1086 ± 29 RLU (p < 0.05). These results suggested that the luxS gene promoted AI-2 production in L. citreum 37.
Fig. 5.
AI-2 production of luxS-pET28a-BL21, pfs-pET28a-BL21, and pET28a-BL21. Data are presented as mean ± standard error of the mean (SEM). n ≥ 3. *p ≤ 0.05, **p ≤ 0.01
The results of NCBI comparison of gene sequence showed that the luxS gene sequence of L. citreum 37 has higher similarity with other strains of leuconostoc. The luxS gene sequence of L. citreum 37 had 83.47% similarity with Leuconostoc suionicum, 83.02% similarity with Leuconostoc mesenteroides, 82.74% similarity with Leuconostoc gelidum, and 82.76% similarity with Leuconostoc pseudomeseteroides.
As far as we know, the luxS genes of three bifidobacterial strains were successfully expressed in AI-2-negative E. coli DH5a. Supernatants of these complementation E. coli strains contained significant AI-2 activity (Sun et al. 2014). In the same way, our data on the complement BL21 with luxS showed that luxS genes play a crucial role in AI-2 synthesis. Biofilm formation was regulated by AI-2 signaling molecules. Therefore, LuxS/AI-2-dependent QS participates in the regulation of L. citreum 37 biofilm formation. This study provides new information about the regulation mechanisms of the LuxS/AI-2 system in L. citreum strain and will be useful for determining the reasonable application of QS.
Conclusions
In this study, we report the complete genome sequence of L. citreum 37 and describe its genomic features. In particular, we found that the LuxS/AI-2-dependent QS of L. citreum 37 is related to its biofilm formation. By sequencing, this study proved that the signaling pathway is complete in L. citreum 37. We identified a potential AI-2 gene, luxS, and found that the AI-2 production and biofilm formation of L. citreum 37 are likely regulated by a QS system.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
This study is supported by the National Natural Science Foundation of China (31860433), the Natural Science Foundation Project of Inner Mongolia Autonomous Region, China (2018MS03026), the Major Projects of Inner Mongolia Autonomous Region (zdzx2018017), and the National Key Research and Development Program of China (2019YF0507604).
Contributor Information
Dejian Zhang, Email: zhangdejian00@163.com.
Rihua Xu, Email: xurihua81@126.com.
References
- Chen QQ, Sa R, Jia JW, Xu RH. Research on biofilm formation ability of lactic acid bacteria under different conditions. Adv J Food Sci Technol. 2017;13(2):77–82. doi: 10.19026/ajfst.13.3769. [DOI] [Google Scholar]
- Christiaen SE, Motherway MO, Bottacini F, Lanigan N, Casey PG, Huys G, Nelis HJ, van Sinderen D, Coenye T. Autoinducer-2 plays a crucial role in gut colonization and probiotic functionality of Bifidobacterium breve UCC2003. PLoS ONE. 2014;9(5):e98111. doi: 10.1371/journal.pone.0098111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han XG, Lu CP. Detection of autoinducer-2 and analysis of the profile of luxS and pfs transcription in Streptococcus suis serotype 2. Curr Microbiol. 2009;58(2):146–152. doi: 10.1007/s00284-008-9291-9. [DOI] [PubMed] [Google Scholar]
- Han XG, Lu CP. In vitro biosynthesis of autoinducer 2 of Steptococcus suis serotype 2 using recombinant LuxS and Pfs. Enzyme Microb Technol. 2009;44(1):40–45. doi: 10.1016/j.enzmictec.2008.09.009. [DOI] [Google Scholar]
- Jang SH, Cha JW, Han NS, Jeong KJ. Development of bicistronic expression system for the enhanced and reliable production of recombinant proteins in Leuconostoc citreum. Sci Rep. 2018;8(1):8852. doi: 10.1038/s41598-018-27091-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jia FF, Zheng HQ, Sun SR, Pang XH, Liang Y, Shang JC, Zhu ZT, Meng XC. Role of luxS in stress tolerance and adhesion ability in Lactobacillus plantarum KLDS1.0391. Biomed Res Int. 2018;2018:4506829. doi: 10.1155/2018/4506829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim SA, Jang YJ, Heo JE, Li L, Moon JS, Han NS. Complete genome sequence of Leuconostoc citreum EFEL2700, a host strain for transformation of pCB vectors. J Biotechnol. 2018;287:52–58. doi: 10.1016/j.jbiotec.2018.08.008. [DOI] [PubMed] [Google Scholar]
- Lebeer S, Verhoeven TL, Perea Vélez M, Vanderleyden J, De Keersmaecker SC. Impact of environmental and genetic factors on biofilm formation by the probiotic strain Lactobacillus rhamnosus GG. Appl Environ Microbiol. 2007;73(21):6768–6775. doi: 10.1128/AEM.01393-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu L, Wu R, Zhang J, Shang N, Li P. d-Ribose interferes with quorum sensing to Inhibit biofilm formation of Lactobacillus paraplantarum L-ZS9. Front Microbiol. 2017;8:1860. doi: 10.3389/fmicb.2017.01860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu L, Wu R, Zhang J, Li P. Overexpression of luxS promotes stress resistance and biofilm formation of Lactobacillus paraplantarum L-ZS9 by regulating the expression of multiple genes. Front Microbiol. 2018;9:2628. doi: 10.3389/fmicb.2018.02628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Martinez-Urtaza J, van Aerle R, Abanto M, Haendiges J, Myers RA, Trinanes J, Baker-Austin C, Gonzalez-Escalona N, Ann Moran M (2017) Genomic Variation and Evolution of Vibrio parahaemolyticus ST36 over the Course of a Transcontinental Epidemic Expansion. mBio 8(6) [DOI] [PMC free article] [PubMed]
- Niu C, Robbins CM, Pittman KJ, Osborn JL, Stubblefield BA, Simmons RB, Gilbert ES. LuxS influences Escherichia coli biofilm formation through autoinducer-2-dependent and autoinducer-2-independent modalities. FEMS Microbiol Ecol. 2012;83(3):778–791. doi: 10.1111/1574-6941.12034. [DOI] [PubMed] [Google Scholar]
- Sharma A, Kaur J, Lee S, Park YS. Analysis of Leuconostoc citreum strains using multilocus sequence typing. Food Sci Biotechnol. 2018;27(6):1755–1760. doi: 10.1007/s10068-018-0417-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song XD, Liu CJ, Huang SH, Li XR, Yang E, Luo YY. Cloning, expression and characterization of two S-ribosylhomocysteine lyases from Lactobacillus plantarum YM-4-3: implication of conserved and divergent roles in quorum sensing. Protein Expr Purif. 2018;145:32–38. doi: 10.1016/j.pep.2017.12.013. [DOI] [PubMed] [Google Scholar]
- Song H, Zhang J, Qu J, Liu J, Yin P, Zhang G, Shang D. Lactobacillus rhamnosus GG microcapsules inhibit Escherichia colibiofilm formation in coculture. Biotechnol Lett. 2019;41(8–9):1007–1014. doi: 10.1007/s10529-019-02694-2. [DOI] [PubMed] [Google Scholar]
- Sun Z, He X, Brancaccio VF, Yuan J, Riedel CU. Bifidobacteria exhibit LuxS-dependent autoinducer-2 activity and biofilm formation. PLoS ONE. 2014;9(2):e88260. doi: 10.1371/journal.pone.0088260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Turovskiy Y, Chikindas ML. Autoinducer-2 bioassay is a qualitative, not quantitative method influenced by glucose. J Microbiol Methods. 2006;66(3):497–503. doi: 10.1016/j.mimet.2006.02.001. [DOI] [PubMed] [Google Scholar]
- Vidal JE, Ludewick HP, Kunkel RM, Zähner D, Klugman KP. The LuxS-dependent quorum-sensing system regulates early biofilm formation by Streptococcus pneumoniae strain D39. Infect Immun. 2011;79(10):4050–4060. doi: 10.1128/IAI.05186-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang X, Li X, Ling J. Streptococcus gordonii LuxS/autoinducer-2 quorum-sensing system modulates the dual-species biofilm formation with Streptococcus mutans. J Basic Microbiol. 2017;57(7):605–616. doi: 10.1002/jobm.201700010. [DOI] [PubMed] [Google Scholar]
- Wright SM, Carroll C, Walters A, Newell PD, Chaston JM. Genome sequence of Leuconostoc citreum DmW_111, isolated from wild Drosophila. Genome Announc. 2017;5(24):e00507–e517. doi: 10.1128/genomeA.00507-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiong ZQ, Kong LH, Lai PF, Xia YJ, Liu JC, Li QY, Ai LZ. Genomic and phenotypic analyses of exopolysaccharide biosynthesis in Streptococcus thermophilus S-3. J Dairy Sci. 2019;102(6):4925–4934. doi: 10.3168/jds.2018-15572. [DOI] [PubMed] [Google Scholar]
- Zhang CL, Li JQ, Guo HT, Xu RH. Selection of exopolysaccharide-producing lactic acid bacteria isolates from Inner Mongolian traditional yoghurt. Mljekarstvo. 2014;64(4):254–260. [Google Scholar]
- Zhang B, Ku X, Zhang X, Zhang Y, Chen G, Chen F, Zeng W, Li J, Zhu L, He Q. The AI-2/luxS quorum sensing system affects the growth characteristics, biofilm formation, and virulence of Haemophilus parasuis. Front Cell Infect Microbiol. 2019;9:62. doi: 10.3389/fcimb.2019.00062. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.