Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Docking pose and docking scores of leader sequence (blue) with the guide strands (A) UCGAAAGUUGGUUGGUUUGUU (B) AUCUACAAGAGAUCGAAAGUU (C) UUAGAGAACAGAUCUACAAGA (D) GUUUAGAGAACAGAUCUACAA of predicted four siRNAs (pink) by siDirect along with information related to off‐targets
