Table 1.
Examples of Random TdT Nucleotide Incorporation/Polymerization
| solution-phase polymerization | G = A > T > C42 | A > G > T > C58 | G > C > T > A65 | A > T > C > G66 | (C > A > G > T)a66 |
| solid-phase polymerizationb | T > C > A > G67 | A > T >> C = G68 | |||
| influence of initiator 3′ nucleotide | T25 > C25 > A25 (dCTP)68 | A25 > C25 = T25 (dATP)68 | A25 = C25 > T25 (dTTP)68 | C25 > T25 = A25 (dGTP)68 | (dTTP > dATP)c43 |
| influence of nearest neighbor nucleotide | 31.9% AA, 24.4% CA, 24.4% AC, and 19.3% CC (dATP, dCTP)d69 | 9.7% AA, 10.1% CA, 12.9% GA, 10.9% CC, 9.2% AC, 10.1% GC, 13.9% GG, 13.8% AG, and 9.2% CG (dATP, dCTP, dGTP)d69 | |||
| influence of metal ions | G > A > C > T (Mg2+)41 | T > C > G > A (Co2+)41 | Zn2+ 70,71 | ||
| mixed-base polymerization | AATCACGGGCGGCGCATCAGGAGAGACGCAAAGATGGCCCCCGGCCTTATCCAGCCATTTCGGCATAAGTGAAAAAAAAAAGCCGGGAAATGGGCACATTTCCAAGGGCGCTTTTACAGGGAGCGGCGCGGCCCTGAACGAGCTTGGCGGCTGAGCCGGCTCGCGCCCCGGAGTCAC (3′) (G > C > A > T) | ||||
Steady-state kinetics employed for single-nucleotide incorporation efficiencies at C > A > G > T.
Surface-initiated enzymatic polymerization (SIEP) on a gold substrate.
Where initiators were terminated with A, G, C, and T, dTTP had an incorporation efficiency that was higher than that of dATP.43
Mixed nucleotides (50% dATP and dCTP and 33% each dATP, dCTP, and dGTP). The efficiency of nucleotide incorporation by TdT (excluding influence of nearest neighbor nucleotide) is based on the extent of polymerization as measured via polyacrylamide gel electrophoresis. All are homopolymers except where otherwise indicated. Mixed-base polymerization (performed in house) showed heteropolymeric ssDNA generation with nucleotide percent incorporation at G > C > A > T; experimental conditions include initiator (20 nt) 40 pm, 20 units of TdT (bovine, NEB), 2 mM dNTP mix (equimolar A, G, C, and T), 1× CoCl2, 1× TdT buffer, water added to a final volume of 20 μL, 37 °C/60 min. Samples were sequenced using the Sanger method.