Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Mus musculus) | ELT3 tumor samples | PMID:29056426 | Valvezan et al., 2017 | |
| Cell line (M. musculus) | WT and Tsc2-/- MEFs | PMID:14561707 | David Kwiatkowski | |
| Cell line (M. musculus) | EIF2aA/A MEFs | PMID:11430820 | Randal Kaufman | |
| Cell line (M. musculus) | Rictor+/+ and Rictor-/- MEFs | PMID:17141160 | D.A. Guertin and D.M. Sabatini | |
| Cell line (Homo sapiens) | PC3 | ATCC | CRL-1435 RRID:CVCL_0035 | |
| Cell line (H. sapiens) | LNCaP | ATCC | CRL-1740 RRID:CVCL_1379 |
|
| Cell line (M. musculus) |
Tsc2+/+ Atf4-/-
MEFs |
This paper | CRISPR-Cas9n generated – see Materials and methods | |
| Cell line (M. musculus) |
Tsc2-/- Atf4-/-
MEFs |
This paper | CRISPR-Cas9n generated – see Materials and methods | |
| Transfected construct (Aequorea victoria) | pTRIPZ-EGFP | This paper | eGFP cDNA- expressing control plasmid – see Materials and methods | |
| Transfected construct (M. musculus) | pTRIPZ-ATF4 | This paper | Rapamycin-resistant ATF4 cDNA-expressing plasmid – see Materials and methods | |
| Transfected construct (M. musculus) | pTRIPZ-ATF4DBD | This paper | ATF4 DNA-binding domain mutant cDNA-expressing plasmid – see Materials and methods | |
| Transfected construct (H. sapiens) | pTRIPZ-SLC7A11 | This paper | SLC7A11 cDNA-expressing plasmid – see Materials and methods | |
| Transfected construct (human, mouse) | Non-targeting pool for siRNA experiments | GE Life Sciences/Dharmacon | D-001810-10-50 | |
| Transfected construct (mouse) | siMyc | GE Life Sciences/Dharmacon | L-040813-00-0010 | |
| Transfected construct (mouse) | siAtf4 | GE Life Sciences/Dharmacon | L-042737-01-0020 | |
| Transfected construct (mouse) | siRheb | GE Life Sciences/Dharmacon | L-057044-00-0020 | |
| Transfected construct (mouse) | siRhebL1 | GE Life Sciences/Dharmacon | L-056074-01-0020 | |
| Transfected construct (mouse) | siTsc2 | GE Life Sciences/Dharmacon | L-047050-00-0020 | |
| Transfected construct (mouse) | siC/ebpα | GE Life Sciences/Dharmacon | L-040561-00-0005 | |
| Transfected construct (mouse) | siC/ebpβ | GE Life Sciences/Dharmacon | L-043110-00-0005 | |
| Transfected construct (mouse) | siC/ebpδ | GE Life Sciences/Dharmacon | L-060294-01-0005 | |
| Transfected construct (mouse) | siC/ebpγ | GE Life Sciences/Dharmacon | L-065627-00-0005 | |
| Transfected construct (human) | siATF4 | GE Life Sciences/Dharmacon | L-005125-00-0020 | |
| Sequenced-based reagent | qPCR primers | IDT | See table in Materials and methods | |
| Recombinant DNA reagent | ATF4 (cDNA amplified from plasmid) | Addgene | RRID:Addgene_21845 | |
| Recombinant DNA reagent | Pspax2 (plasmid) | Addgene | RRID:Addgene_12260 | |
| Recombinant DNA reagent | Pmd2.G (plasmid) | Addgene | RRID:Addgene_12259 | |
| Recombinant DNA reagent | pSpCas9n(BB)−2A-GFP (PX461) (plasmid) | Addgene | RRID:Addgene_48140 | |
| Recombinant DNA reagent | pTRIPZ (plasmid) | PMID:27088857 | Alex Toker (Beth Israel Deaconess Medical Center) | |
| Recombinant DNA reagent | GFP (cDNA amplified from plasmid) | Addgene | RRID:Addgene_19319 | |
| Recombinant DNA reagent | SLC7A11 (cDNA amplified from plasmid) | PMID:29259101 | Alex Toker (Beth Israel Deaconess Medical Center) | |
| Recombinant DNA reagent | pBabe hygro IRES-TSC2 | PMID:15150095 | David Kwiatkowski (Brigham and Women’s Hospital) | |
| Sequenced-based reagent | CRISPR-Cas9n guides for KO of ATF4 | IDT | CACCGGAGGTGGAGGGGCTATGCT; AAACAGCATAGCCCCTCCACCTCC; CACCGACAATCTGCCTTCTCCAGG; AAACCCTGGAGAAGGCAGATTGTC | |
| Sequenced-based reagent | Sequencing primers for Atf4-/- cell lines | IDT | TCGATGCTCTGTTTCGAATG; CTTCTTCCCCCTTGCCTTAC | |
| Sequenced-based reagent | Primers for site-directed mutagenesis | IDT | GCCTCCTGCTCAGCCGCCGCCGCCTCGAGGTACCCAGTGGCTGCTGTCTTGTTTTGCTCCATCT; AGATGGAGCAAAACAAGACAGCAGCCACTGGGTACCTCGAGGCGGCGGCGGCTGAGCAGGAGGC | |
| Commercial assay or kit | KOD Xtreme Hot Start DNA Polymerase | Sigma-Aldrich | 71975 | |
| Antibody | (P)-S6K1 T389 rabbit monoclonal |
Cell Signaling Technologies (CST) | Cat #: 9234 RRID:AB_2269803 |
1:1000, 10 μL |
| Antibody | ATF4 rabbit monoclonal |
Cell Signaling Technologies (CST) | Cat #: 11815 RRID:AB_2616025 |
1:1000, 10 μL |
| Antibody | eIF2α rabbit polyclonal | Cell Signaling Technologies | Cat #: 9722 RRID:AB_2230924 |
1:1000, 10 μL |
| Antibody | P-eIF2α S51 rabbit polyclonal |
Cell Signaling Technologies | Cat #: 9721 RRID:AB_330951 |
1:1000, 10 μL |
| Antibody | S6K1 rabbit monoclonal |
Cell Signaling Technologies | Cat #: 2708 RRID:AB_390722 |
1:1000, 10 μL |
| Antibody | CD98 rabbit monoclonal |
Cell Signaling Technologies | Cat #: 13180 RRID:AB_2687475 |
1:1000, 10 μL |
| Antibody | PSAT1 rabbit polyclonal | Protein Tech | Cat #: 20180-1-AP RRID:AB_10665948 |
1:1000, 10 μL |
| Antibody | MTHFD2 rabbit polyclonal |
Protein Tech | Cat #: 12270–1-AP RRID:AB_2147525 |
1:1000, 10 μL |
| Antibody | AARS rabbit polyclonal | Bethyl Antibodies | A303-475A-M | 1:1000, 10 μL |
| Antibody | GARS rabbit polyclonal | Bethyl Antibodies | A304-746A-M | 1:1000, 10 μL |
| Antibody | LARS rabbit polyclonal | Bethyl Antibodies | A304-316A-M | 1:1000, 10 μL |
| Antibody | XPOT rabbit polyclonal | Aviva Biotechnologies | Cat #: ARP40711_P050 RRID:AB_2048757 | 1:1000, 10 μL |
| Antibody | TSC2 rabbit monoclonal |
Cell Signaling Technologies | Cat #: 4308 RRID:AB_10547134 |
1:1000, 10 μL |
| Antibody | SLC7A11 rabbit monoclonal | Abcam | Cat #: ab175186 RRID:AB_2722749 |
1:1000, 10 μL For immunoblots of WT and Tsc2-/- MEFs |
| Antibody | SLC7A11 rabbit monoclonal | Cell Signaling Technologies | Cat #: 12691 RRID:AB_2687474 |
1:1000, 10 μL For immunoblots of PC3 and LNCaP cell lines |
| Antibody | GCLC rabbit monoclonal | Abcam | ab190685 | 1:1000, 10 μL |
| Antibody | GCLM rabbit monoclonal | Abcam | Cat#: ab126704 RRID:AB_11127439 |
1:1000, 10 μL |
| Antibody | RICTOR rabbit monoclonal | Cell Signaling Technologies | Cat #: 9476 RRID:AB_10612959 | 1:1000, 10 μL |
| Antibody | RHEB rabbit monoclonal | Cell Signaling Technologies | Cat #: 13879 RRID:AB_2721022 | 1:1000, 10 μL |
| Antibody | 4EBP1 rabbit monoclonal | Cell Signaling Technologies | Cat #: 9644 RRID:AB_2097841 | 1:1000, 10 μL |
| Antibody | c-MYC rabbit polyclonal | Cell Signaling Technologies | Cat #: 9402 RRID:AB_2151827 | 1:1000, 10 μL |
| Antibody | β-Actin mouse monoclonal | Sigma | Cat #: A5316 RRID:AB_476743 | 1:5000, 2 μL |
| Antibody | HRP-conjugated anti-rabbit rabbit polyclonal | CST | Cat #: 7074 RRID:AB_2099233 |
1:5000, 2 μL |
| Antibody | HRP-conjugated anti-mouse mouse polyclonal | CST | Cat #: 7076 RRID:AB_330924 |
1:5000, 2 μL |
| Antibody | IRDye 800CW Donkey anti-Rabbit IgG rabbit polyclonal | LI-COR | Cat #: 925–32213 RRID:AB_2715510 |
1:5000, 2 μL |
| Antibody | IRDye 800CW Donkey anti-Mouse IgG mouse polyclonal | LI-COR | Cat #: 926-32212 RRID:AB_621847 |
1:5000, 2 μL |
| Chemical compound, drug | Doxycycline hydrochloride | Sigma | D3447 | |
| Chemical compound, drug | Rapamycin | LC Laboratories | R5000 | |
| Chemical compound, drug | Insulin | Alpha Diagnostic, | INSL 16 N-5 | |
| Chemical compound, drug | Tunicamycin | Sigma-Aldrich | T7765 | |
| Chemical compound, drug | Torin1 | Tocris | 4247 | |
| Chemical compound, drug | Erastin | Selleckchem | S7242 | |
| Chemical compound, drug | Buthionine-sulfoximine (BSO) | Sigma | B2515 | |
| Chemical compound, drug | Hygromycin B | Thermo Fisher Scientific | 10687010 | |
| Chemical compound, drug | Puromycin | Sigma | P8833 | |
| Chemical compound, drug | Staurosporine | Tocris | 1285 | |
| Chemical compound, drug | Cysteine | Sigma | C7477 | |
| Chemical compound, drug | Cystine | Sigma | 57579 | |
| Chemical compound, drug | 2-Mercaptoethanol | EMD Millipore | 444203 | |
| Chemical compound, drug | MEM Nonessential amino acids solution | Thermo Fisher Scientific |
11140050 | |
| Chemical compound, drug | 35S-methionine | PerkinElmer | NEG009L005MC | |
| Chemical compound, drug | L-[1, 2, 1', 2'-14C]-Cystine | PerkinElmer | NEC854010UC | |
| Commercial assay or kit | FITC Annexin V Apoptosis Detection Kit I | BD | 556547 | |
| Commercial assay or kit | GSH/GSSG-Glo Assay | Promega | V6611 |