Appendix 1—key resources table.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Antibody | Mouse monoclonal anti-brp | DSHB | Cat# nc82; RRID:AB_2314866 | IF (1:50) |
Antibody | Rabbit monoclonal anti-HA-Tag | Cell Signaling Technology | Cat# 3724; RRID:AB_1549585 | IF (1:100) |
Antibody | Mouse monoclonal anti-HA-Tag | Cell Signaling Technology | Cat# 2367; RRID:AB_10691311 | IF (1:100) WB (1:1000) |
Antibody | Rat monoclonal anti-Deadpan | Abcam | Cat# ab195173; RRID:AB_2687586 | IF (1:100) |
Antibody | Goat polyclonal anti-mouse Alexa-488 | Thermo Fisher Scientific | Cat# A32723; RRID:AB_2633275 | IF (1:500) |
Antibody | Goat polyclonal anti-mouse Alexa-568 | Thermo Fisher Scientific | Cat# A11004; RRID:AB_2534072 | IF (1:500) |
Antibody | Goat polyclonal anti-rabbit Alexa-488 | Thermo Fisher Scientific | Cat# A11034; RRID:AB_2576217 | IF (1:500) |
Antibody | Goat polyclonal anti-rabbit Alexa-568 | Thermo Fisher Scientific | Cat# A11004, RRID:AB_2534072 | IF (1:500) |
Antibody | Goat polyclonal anti-rat Alexa-568 | Thermo Fisher Scientific | Cat# A11077; RRID:AB_2534121 | IF (1:500) |
Antibody | Mouse monoclonal anti-Fas2 | DSHB | Cat# 1D4; RRID:AB_528235 | IF (1:25) |
Antibody | Rabbit polyclonal anti-KDM5 | Secombe Lab; Secombe et al., 2007 | RRID:AB_2569502 | WB (1:1000) |
Antibody | IRDye 680RD donkey monoclonal anti-mouse IgG secondary antibody | LI-COR Biosciences | LI-COR Biosciences Cat# 925-68072, RRID:AB_2814912 | WB (1:8000) |
Antibody | IRDye 800CW donkey monoclonal anti-rabbit IgG secondary antibody | LI-COR Biosciences | LI-COR Biosciences Cat# 926-32213, RRID:AB_621848 | WB (1:8000) |
Cell line (Escherichia coli) | NEB 5-alpha competent E. coli | New England BioLabs | Cat# C2987 | |
Commercial assay or kit | Clontech CloneAmp HiFi PCR Premix | Clontech | Cat# 639298 | |
Commercial assay or kit | Advantage 2 cDNA polymerase | Clontech | Cat# 639201 | |
Commercial assay or kit | Agencourt AMPure XP Beads | Beckman Coulter | Cat# A63880 | |
Commercial assay or kit | Takara In-Fusion HD Cloning Plus | Takara | Cat# 638909 | |
Commercial assay or kit | Quick Ligation Kit | New England BioLabs | Cat# M2200S | |
Commercial assay or kit | Zymo Quick-DNA miniprep plus | Zymo Research | Cat# D4069 | |
Commercial assay or kit | Macherey-Nagel NucleoSpin Gel and PCR Clean-up Kit | Takara | Cat# 740609.250 | |
Commercial assay or kit | Qubit dsDNA HS Assay Kit | Invitrogen | Cat# Q32851 | |
Genetic reagent (Drosophila melanogaster) | Drosophila: kdm5:3xHA | This study | N/A | Endogenous kdm5:HA strain (Figures 2–4). Available from lead contact. |
Genetic reagent (D. melanogaster) | Drosophila: OK107-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_854 | |
Genetic reagent (D. melanogaster) | Drosophila: 5XUAS-unc84::2XGFP | Janelia Research Campus; Henry et al., 2012 | N/A | |
Genetic reagent (D. melanogaster) | Drosophila: wor-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_56553 | |
Genetic reagent (D. melanogaster) | Drosophila: UAS-kdm5RNAI | Bloomington Drosophila Stock Center | RRID:BDSC_35706 | |
Genetic reagent (D. melanogaster) | Drosophila: insc-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_8751 | |
Genetic reagent (D. melanogaster) | Drosophila: c708a-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_50743 | |
Genetic reagent (D. melanogaster) | Drosophila: c305a-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_30829 | |
Genetic reagent (D. melanogaster) | Drosophila: H24-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_51632 | |
Genetic reagent (D. melanogaster) | Drosophila: 201Y-Gal4 | Bloomington Drosophila Stock Center | RRID:BDSC_4440 | |
Genetic reagent (D. melanogaster) | Drosophila: UAS-Dcr-2 | Bloomington Drosophila Stock Center | RRID:BDSC_24650 | |
Genetic reagent (D. melanogaster) | Drosophila: GMR71C09-GAL4 | Bloomington Drosophila Stock Center | RRID:BDSC_39575 | |
Genetic reagent (D. melanogaster) | Drosophila: 20XUAS-IVS-CsChrimson.mVenus | Bloomington Drosophila Stock Center | RRID:BDSC_55136 | |
Genetic reagent (D. melanogaster) | Drosophila: kdm5NP4707 | Kyoto Stock Center; Hayashi et al., 2002 | ; stock# 104754 | |
Genetic reagent (D. melanogaster) | Drosophila: kdm5140 | Secombe Lab; Drelon et al., 2018 | ||
Genetic reagent (D. melanogaster) | Drosophila: UASt-kdm5 | Secombe Lab; Secombe et al., 2007 | ||
Genetic reagent (D. melanogaster) | Drosophila: UAS-dMycRNAi | Vienna Drosophila Resource Center | Stock# KK106066 | |
Genetic reagent (D. melanogaster) | Drosophila: UAS-prosRNAi | Bloomington Drosophila Stock Center | RRID:BDSC_42538 | |
Genetic reagent (D. melanogaster) | Drosophila: tubP-Gal80ts | Bloomington Drosophila Stock Center | RRID:BDSC_7019 | |
Genetic reagent (D. melanogaster) | Drosophila: UAS-LT3-NDam | Brand Lab; Southall et al., 2013 | ||
Genetic reagent (D. melanogaster) | Drosophila: UAS-LT3-NDam-RpII215 | Brand Lab; Southall et al., 2013 | ||
Genetic reagent (D. melanogaster) | Drosophila: w1118 | Bloomington Drosophila Stock Center | RRID:BDSC_5905 | |
Genetic reagent (D. melanogaster) | Drosophila: UAS-LT3-NDam-kdm5 | This study | N/A | Used for KDM5 TaDa (Figures 6 and 7). Available from lead contact. |
Sequence-based reagent | AdRt | Vogel et al., 2007 | PCR primers | CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA |
Sequence-based reagent | AdRb | Vogel et al., 2007 | PCR primers | TCCTCGGCCG |
Sequence-based reagent | DamID_PCR | Vogel et al., 2007 | PCR primers | GGTCGCGGCCGAGGATC |
Sequence-based reagent | scram_shRNA | This study | PCR primers | GGATAATAGAATAGTTATATTCAAGCATATTCTATTATCC |
Sequence-based reagent | Fw DsRed_KDM5_AarI | This study | PCR primers | tatagtgtcttcggggccgaCAGGAGCTGTGGCGCATTCTAGAAAC |
Sequence-based reagent | PAM Rv | This study | PCR primers | AATCTGGAACATCGTATGGGTACTGCGGCCGCGCTCGCGC |
Sequence-based reagent | PAM Fw | This study | PCR primers | AGCAGCGGGCGGTGCAATCGGCGCGAGCGCGGCCGCAGTA |
Sequence-based reagent | Rv DsRed_KDM5_AarI | This study | PCR primers | gattatctttctagggttaaAGGAAAAAGTCAAATAAAACGTAAGAAAACTTTGC |
Sequence-based reagent | Fw DsRed_KDM5_SapI | This study | PCR primers | gactatctttctagggttaaTCAAAGGCGAAGGCGACTCT |
Sequence-based reagent | Rv DsRed_KDM5_SapI | This study | PCR primers | atatggtcttcttttcccggAACATGTTCCTCTTTTAAGGTGCTCTTT |
Sequence-based reagent | Dam-kdm5_NotI-Fw | This study | PCR primers | cgcagatctgcggccgATGTCCGCCAAAACTGAGG |
Sequence-based reagent | Dam-kdm5_XbaI-Rv | This study | PCR primers | acaaagatcctctagCTACCGCGCCGATTGCAC |
Recombinant DNA reagent | pU6-BbsI-chiRNA | Addgene; Gratz et al., 2013 | RRID:Addgene_45946 | |
Recombinant DNA reagent | pValium20 | Drosophila Genomics Resource Center; Ni et al., 2009 | DGRC# 1467 | |
Recombinant DNA reagent | pHD-ScarlessDsRed | Drosophila Genomics Resource Center | DGRC# 1364 | |
Software, algorithm | Fiji | https://fiji.sc/ | RRID:SCR_002285 | |
Software, algorithm | Prism 6 | GraphPad | RRID:SCR_002798 | |
Software, algorithm | Cytoscape | https://cytoscape.org/ | RRID:SCR_003032 | |
Software, algorithm | Gene Ontology | http://www.geneontology.org | RRID:SCR_002811 | |
Software, algorithm | R 3.5.1 | The R Foundation | RRID:SCR_001905 | |
Software, algorithm | ggplot2 (R package) | CRAN | RRID:SCR_014601 | |
Software, algorithm | damidseq_pipeline | Marshall and Brand, 2015a | http://owenjm.github.io/damidseq_pipeline/ | |
Software, algorithm | find_peaks |
Wolfram et al., 2012 |
http://github.com/owenjm/find_peaks | |
Software, algorithm | bowtie2 |
Langmead and Salzberg, 2012 |
http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | |
Software, algorithm | BioVenn | Hulsen et al., 2008 | https://www.biovenn.nl/ | |
Other | Vectashield Mounting Medium | Vector Labs | Cat# H-1000 | |
Other | Normal donkey serum | Fisher Scientific | Cat# 50-413-367 | |
Other | DAPI-Fluoromount-G | SouthernBiotech | Cat# OB010020 | |
Other | T4 DNA ligase | New England BioLabs | Cat# M0202 | |
Other | T4 polynucleotide kinase | New England BioLabs | Cat# M0201 | |
Other | AarI | Thermo Scientific | Cat# ER1581 | |
Other | SapI | New England BioLabs | Cat# R0569 | |
Other | BpiI | Thermo Scientific | Cat# ER1011 | |
Other | NotI | New England BioLabs | Cat# R0189 | |
Other | PstI | New England BioLabs | Cat# R0140 | |
Other | NheI | New England BioLabs | Cat# R0131 | |
Other | EcoRI | New England BioLabs | Cat# R0101 | |
Other | DpnI | New England BioLabs | Cat# R0176 | |
Other | DpnII | New England BioLabs | Cat# R0543 | |
Other | AlwI | New England BioLabs | Cat# R0513 |