Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens; female) | BLaER1 B-cell precursor leukemia |
Laboratory of Thomas Graf | RRID:CVCL_VQ57 | RCH-ACV stably expressing estrogen inducible C/EBPα |
| Commercial assay, kit | Plasmo Test Mycoplasma Detection Kit | InvivoGen | rep-pt1 | |
| Commercial assay, kit | NUGEN Ovation V2 Kit | NUGEN | 0343 | |
| Commercial assay, kit | NEB Ultra DNA Library kit | NEB | E7370S | |
| Commercial assay, kit | KAPA Real-Time Library Amplification Kit | Peqlab | KK2701 | |
| Commercial assay, kit | Nextera Tn5 Transposase | Illumina | FC-121–1030 | |
| Chemical compound, drug | Human CSF-1 | PEPROTECH | 300–25 | |
| Chemical compound, drug | Human IL-3 | PEPROTECH | 200–03 | |
| Chemical compound, drug | β-estradiol | CALBIOCHEM | 3301 | |
| Chemical compound, drug | 4-thiouridine | Carbosynth | 13957-31-8 | |
| Antibody | Anti-C/EBPα (rabbit polyclonal) | Santa Cruz | Cat# sc-61, RRID:AB_631233 | ChIP-seq (5 μg for 50 μg of chromatin) |
| Antibody | Anti-H3K4me1 (rabbit polyclonal) | Abcam | Cat# ab8895, RRID:AB_306847 | ChIP-seq (5 μg for 30 μg of chromatin) |
| Antibody | Anti-BRD4 (rabbit polyclonal) | Bethyl Laboratories | Cat# A301-985A100, RRID:AB_2620184 | ChIP-seq (5 μg for 100 μg of chromatin) |
| Antibody | Anti-human CD19-APC-cy7APC-cy7 mouse anti-human CD19(mouse monoclonal) | BD Biosciences | Cat# 557791, RRID:AB_396873 | FACS (2.5 μL per test) |
| Antibody | Anti-human CD14-PEPE mouse anti-human CD14 (mouse monoclonal) | BD Biosciences | Cat# 555398, RRID:AB_395799 | FACS (5 μL per test) |
| Sequenced-based reagent | CD19 forward | Rapino et al., 2013 | qPCR primers | GATGCAGACTCTTATGAGAAC |
| Sequenced-based reagent | CD19 reverse | Rapino et al., 2013 | qPCR primers | TCAGATTTCAGAGTCAGGTG |
| Sequenced-based reagent | IGJ forward | Rapino et al., 2013 | qPCR primers | TGTTCATGTGAAAGCCCAAG |
| Sequenced-based reagent | IGJ reverse | Rapino et al., 2013 | qPCR primers | TCGGATGTTTCTCTCCACAA |
| Sequenced-based reagent | VPREB3 forward | Rapino et al., 2013 | qPCR primers | GGGGACCTTCCTGTCAGTTT |
| Sequenced-based reagent | VPREB3 reverse | Rapino et al., 2013 | qPCR primers | ACCGTAGTCCCTGATGGTGA |
| Sequenced-based reagent | CD14 forward | Rapino et al., 2013 | qPCR primers | GATTACATAAACTGTCAGAGGC |
| Sequenced-based reagent | CD14 reverse | Rapino et al., 2013 | qPCR primers | TCCATGGTCGATAAGTCTTC |
| Sequenced-based reagent | FCGR1B forward | Rapino et al., 2013 | qPCR primers | CCTTGAGGTGTCATGCGTG |
| Sequenced-based reagent | FCGR1B reverse | Rapino et al., 2013 | qPCR primers | AAGGCTTTGCCATTTCGATAGT |
| Sequenced-based reagent | ITGAM forward | Rapino et al., 2013 | qPCR primers | GGGGTCTCCACTAAATATCTC |
| Sequenced-based reagent | ITGAM reverse | Rapino et al., 2013 | qPCR primers | CTGACCTGATATTGATGCTG |
| Sequenced-based reagent | GAPDH forward | This paper | qPCR primers | TCTCTGCTCCTCCTGTTCGAC |
| Sequenced-based reagent | GAPDH reverse | This paper | qPCR primers | GGCGCCCAATACGACCAAAT |
| Software, algorithm | Cutadapt | Martin, 2012 | RRID:SCR_011841 | Version 1.9.1 |
| Software, algorithm | Trim Galore | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ | RRID:SCR_011847 | Version 0.4.1 |
| Software, algorithm | FastQC | http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc | RRID:SCR_014583 | |
| Software, algorithm | SAMTOOLS | Li et al., 2009 | RRID:SCR_002105 | Version 1.2 |
| Software, algorithm | STAR | Dobin et al., 2013 | RRID:SCR_004463 | Version 2.4.2 |
| Software, algorithm | DESeq2 | Love et al., 2014 | RRID:SCR_015687 | |
| Software, algorithm | Bowtie 2 | Langmead and Salzberg, 2012 | RRID:SCR_016368 | Version 2.2.5 |
| Software, algorithm | MACS | Zhang et al., 2008 | RRID:SCR_013291 | Version 2.1.1 |
| Software, algorithm | Bowtie | Langmead et al., 2009 | RRID:SCR_005476 | Version 1.0.0 |
| Software, algorithm | HTSeq | Anders et al., 2015 | RRID:SCR_005514 | Version 0.6.1p1 |
| Software, algorithm | ggplot2 | http://ggplot2.org | RRID:SCR_014601 | |
| Software, algorithm | Pheatmap | https://CRAN.R-project.org/package=pheatmap | RRID:SCR_016418 | |
| Software, algorithm | DAVID | Huang et al., 2009 | RRID:SCR_001881 | |
| Software, algorithm | GenoSTAN | Zacher et al., 2017 | ||
| Software, algorithm | MEME Suite - motif-based sequence analysis tools | Bailey et al., 2009 | RRID:SCR_001783 | Version 4.11.2 |
| Software, algorithm | 3D Genome | http://promoter.bx.psu.edu/hi-c/ | RRID:SCR_017525 | |
| Software, algorithm | DEoptim | Dukler et al., 2017 | ||
| Software, algorithm | ROSE | Lovén et al., 2013; Whyte et al., 2013 | RRID:SCR_017390 | |
| Software, algorithm | PIQ | Sherwood et al., 2014 | ||
| Software, algorithm | TFBSTool | Tan and Lenhard, 2016 |