Skip to main content
. 2021 Mar 26;10:e65381. doi: 10.7554/eLife.65381

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Cell line (Homo sapiens; female) BLaER1
B-cell precursor leukemia
Laboratory of Thomas Graf RRID:CVCL_VQ57 RCH-ACV stably expressing estrogen inducible C/EBPα
Commercial assay, kit Plasmo Test Mycoplasma Detection Kit InvivoGen rep-pt1
Commercial assay, kit NUGEN Ovation V2 Kit NUGEN 0343
Commercial assay, kit NEB Ultra DNA Library kit NEB E7370S
Commercial assay, kit KAPA Real-Time Library Amplification Kit Peqlab KK2701
Commercial assay, kit Nextera Tn5 Transposase Illumina FC-121–1030
Chemical compound, drug Human CSF-1 PEPROTECH 300–25
Chemical compound, drug Human IL-3 PEPROTECH 200–03
Chemical compound, drug β-estradiol CALBIOCHEM 3301
Chemical compound, drug 4-thiouridine Carbosynth 13957-31-8
Antibody Anti-C/EBPα (rabbit polyclonal) Santa Cruz Cat# sc-61, RRID:AB_631233 ChIP-seq (5 μg for 50 μg of chromatin)
Antibody Anti-H3K4me1 (rabbit polyclonal) Abcam Cat# ab8895, RRID:AB_306847 ChIP-seq (5 μg for 30 μg of chromatin)
Antibody Anti-BRD4 (rabbit polyclonal) Bethyl Laboratories Cat# A301-985A100, RRID:AB_2620184 ChIP-seq (5 μg for 100 μg of chromatin)
Antibody Anti-human CD19-APC-cy7APC-cy7 mouse anti-human CD19(mouse monoclonal) BD Biosciences Cat# 557791, RRID:AB_396873 FACS (2.5 μL per test)
Antibody Anti-human CD14-PEPE mouse anti-human CD14 (mouse monoclonal) BD Biosciences Cat# 555398, RRID:AB_395799 FACS (5 μL per test)
Sequenced-based reagent CD19 forward Rapino et al., 2013 qPCR primers GATGCAGACTCTTATGAGAAC
Sequenced-based reagent CD19 reverse Rapino et al., 2013 qPCR primers TCAGATTTCAGAGTCAGGTG
Sequenced-based reagent IGJ forward Rapino et al., 2013 qPCR primers TGTTCATGTGAAAGCCCAAG
Sequenced-based reagent IGJ reverse Rapino et al., 2013 qPCR primers TCGGATGTTTCTCTCCACAA
Sequenced-based reagent VPREB3 forward Rapino et al., 2013 qPCR primers GGGGACCTTCCTGTCAGTTT
Sequenced-based reagent VPREB3 reverse Rapino et al., 2013 qPCR primers ACCGTAGTCCCTGATGGTGA
Sequenced-based reagent CD14 forward Rapino et al., 2013 qPCR primers GATTACATAAACTGTCAGAGGC
Sequenced-based reagent CD14 reverse Rapino et al., 2013 qPCR primers TCCATGGTCGATAAGTCTTC
Sequenced-based reagent FCGR1B forward Rapino et al., 2013 qPCR primers CCTTGAGGTGTCATGCGTG
Sequenced-based reagent FCGR1B reverse Rapino et al., 2013 qPCR primers AAGGCTTTGCCATTTCGATAGT
Sequenced-based reagent ITGAM forward Rapino et al., 2013 qPCR primers GGGGTCTCCACTAAATATCTC
Sequenced-based reagent ITGAM reverse Rapino et al., 2013 qPCR primers CTGACCTGATATTGATGCTG
Sequenced-based reagent GAPDH forward This paper qPCR primers TCTCTGCTCCTCCTGTTCGAC
Sequenced-based reagent GAPDH reverse This paper qPCR primers GGCGCCCAATACGACCAAAT
Software, algorithm Cutadapt Martin, 2012 RRID:SCR_011841 Version 1.9.1
Software, algorithm Trim Galore https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ RRID:SCR_011847 Version 0.4.1
Software, algorithm FastQC http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc RRID:SCR_014583
Software, algorithm SAMTOOLS Li et al., 2009 RRID:SCR_002105 Version 1.2
Software, algorithm STAR Dobin et al., 2013 RRID:SCR_004463 Version 2.4.2
Software, algorithm DESeq2 Love et al., 2014 RRID:SCR_015687
Software, algorithm Bowtie 2 Langmead and Salzberg, 2012 RRID:SCR_016368 Version 2.2.5
Software, algorithm MACS Zhang et al., 2008 RRID:SCR_013291 Version 2.1.1
Software, algorithm Bowtie Langmead et al., 2009 RRID:SCR_005476 Version 1.0.0
Software, algorithm HTSeq Anders et al., 2015 RRID:SCR_005514 Version 0.6.1p1
Software, algorithm ggplot2 http://ggplot2.org RRID:SCR_014601
Software, algorithm Pheatmap https://CRAN.R-project.org/package=pheatmap RRID:SCR_016418
Software, algorithm DAVID Huang et al., 2009 RRID:SCR_001881
Software, algorithm GenoSTAN Zacher et al., 2017
Software, algorithm MEME Suite - motif-based sequence analysis tools Bailey et al., 2009 RRID:SCR_001783 Version 4.11.2
Software, algorithm 3D Genome http://promoter.bx.psu.edu/hi-c/ RRID:SCR_017525
Software, algorithm DEoptim Dukler et al., 2017
Software, algorithm ROSE Lovén et al., 2013; Whyte et al., 2013 RRID:SCR_017390
Software, algorithm PIQ Sherwood et al., 2014
Software, algorithm TFBSTool Tan and Lenhard, 2016