Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Drosophila melanogaster) | Elav-GS | Osterwalder et al., 2001 | ||
| Genetic reagent (D. melanogaster) | Da-GS | Tricoire et al., 2009 | ||
| Genetic reagent (D. melanogaster) | GMR-GAL4 | Bloomington Drosophila Stock Center | BL#9146 RRID:BDSC_9146 |
|
| Genetic reagent (D. melanogaster) | Dilp3-GAL4 | Bloomington Drosophila Stock Center | BL#52660 RRID:BDSC_52660 |
|
| Genetic reagent (D. melanogaster) | UAS-(G4C2)36 | Mizielinska et al., 2014 | ||
| Genetic reagent (D. melanogaster) | UAS-GR100 | Mizielinska et al., 2014 | ||
| Genetic reagent (D. melanogaster) | UAS-InRActive | Bloomington Drosophila Stock Center | BL#8263 RRID:BDSC_8263 |
|
| Genetic reagent (D. melanogaster) | UAS-InRDN | Bloomington Drosophila Stock Center | BL#8252 RRID:BDSC_8252 |
|
| Genetic reagent (D. melanogaster) | UAS-PI3KCA | Bloomington Drosophila Stock Center | BL#25908 RRID:BDSC_25908 |
|
| Genetic reagent (D. melanogaster) | UAS-AktCA | Bloomington Drosophila Stock Center | BL#8194 RRID:BDSC_8194 |
|
| Genetic reagent (D. melanogaster) | UAS-mCD8::GFP | Lee and Luo, 1999 | ||
| Cell line (Homo sapiens) |
HEK293T cells | UCL Drug Discovery Institute | Mycoplasma negative HEK cells | |
| Recombinant DNA reagent | pGL4.53[luc2/PGK] Vector | Promega | #E5011 | Firefly luciferase reporter plasmid |
| Transfected construct (H. sapiens) |
92 repeat G4C2nanoluciferase reporter | UCL Dementia Research Institute | ||
| Antibody | Anti-GFP (mouse, mix of two monoclonals) | Merck | Cat#11814460001 RRID:AB_390913 |
WB (1:10.000) |
| Antibody | Anti-GR (rabbit) |
Moens et al., 2018 | MSD Capture: 2 µg/ml Detection: 12 µg/ml |
|
| Antibody | Anti-GR (rat, monoclonal) |
Mori et al., 2013 | 5H9 | IF (1:50) |
| Antibody | Anti-dilp2 (rabbit, polyclonal) |
Okamoto et al., 2012 | IF (1:500) | |
| Antibody | Anti-non-P 4E-BP1(rabbit monoclonal) | Cell Signalling | Cat#4923: RRID:AB_659944 |
WB (1:1000) |
| Antibody | Anti-P 4E-BP1 (rabbit monoclonal) | Cell Signalling | Cat#2855 RRID:AB_560835 |
WB (1:1000) |
| Antibody | Anti-p53 (mouse monoclonal) | DSHB | Dmp53-H3 RRID:AB_10804170 |
WB (1:200) |
| Antibody | Anti-actin (mouse monoclonal) |
Abcam | Cat#Ab8224 RRID:AB_449644 |
WB (1:10.0000) |
| Antibody | Anti-tubulin (mouse monoclonal) |
Sigma- Aldrich | Cat#T6199 RRID:AB_477583 |
WB (1:2000) |
| Antibody | Anti-rat IgG-Alexa fluor 647 (goat polyclonal) |
ThermoFisher | Cat#A21247 RRID:AB_141778 |
IF (1:1000) |
| Antibody | Anti-rabbit IgG-Alexa fluor 488 (goat polyclonal) | ThermoFisher | Cat#A32731 RRID:AB_2633280 |
IF (1:1000) |
| Antibody | HRP-conjugated anti-mouse (goat polyclonal) | Abcam | Cat#Ab6789 RRID:AB_955439 |
WB (1:10.000) |
| Antibody | HRP-conjugated anti-rabbit (goat polyclonal) | Abcam | Cat#Ab6721 RRID:AB_955447 |
WB (1:10.000) |
| Sequence-based reagent | Dilp2_forward | Broughton et al., 2008 | PCR primers | ATGAGCAAGCCTTTGTCCTTC |
| Sequence-based reagent | Dilp2_reverse | Broughton et al., 2008 | PCR primers | GACCACGGAGCAGTACTCCC |
| Sequence-based reagent | Dilp3_forward | This study | PCR primers | AGAGAACTTTGGACCCCGTGAA |
| Sequence-based reagent | Dilp3_reverse | This study | PCR primers | TGAACCGAACTATCACTCAACAGTCT |
| Sequence-based reagent | Dilp5_forward | This study | PCR primers | GAGGCACCTTGGGCCTATTC |
| Sequence-based reagent | Dilp5_reverse | This study | PCR primers | CATGTGGTGAGATTCGGAGCTA |
| Sequence-based reagent | Tubulin_forward | Moens et al., 2019 | PCR primers | TGGGCCCGTCTGGACCACAA |
| Sequence-based reagent | Tubulin_reverse | Moens et al., 2019 | PCR primers | TCGCCGTCACCGGAGTCCAT |