Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rabbit polyclonal to pSmad2/3 | Santa Cruz | sc-11769 | 1:50 |
| Antibody | Rabbit polyclonal to Osterix | Abcam | ab22552 | 1:600 |
| Antibody | Rabbit polyclonal to TβRII | Abcam | ab186838 | 1:100 |
| Antibody | Mouse monoclonal to β-actin | Cell Signaling Technology | CST3700 | 1:3000 |
| Antibody | Rabbit polyclonal to COX2 | Abcam | ab15191 | 1:100 |
| Antibody | Rabbit polyclonal to MMP13 | Abcam | ab39012 | 1:200 |
| Antibody | Chicken polyclonal to Nestin | Aves Labs | NES0407 | 1:300 |
| Antibody | Mouse monoclonal to CGRP | Abcam | ab81887 | 1:200 |
| Antibody | Rat monoclonal to Substance P | Santa Cruz | sc-21715 | 1:200 |
| Antibody | Rat monoclonal to endomucin | Santa Cruz | sc-65495 | 1:50 |
| Antibody | Rabbit polyclonal to PIEZO2 | Abcam | ab243416 | 1:300 |
| Antibody | Rabbit polyclonal to P2 × 3 | Abcam | ab10269 | 1:500 |
| Strain, strain background (Mus musculus) | C57BL/6J mice | Charles River Laboratories | Strain Code: 27 | C57BL/6 background |
| Strain, strain background (Mus musculus) | Pth1rfl/fl | Kobayashi et al., 2002 | Charles River Laboratories | C57BL/6 background |
| Strain, strain background (Mus musculus) | Nestin-creERT2 | Stock No: 016261 | Jackson Laboratory | C57BL/6 background |
| Chemical compound, drug | human PTH (1-34) | Sigma-Aldrich | P3796 | N/A |
| Sequence- based reagent | Nestin-creERT2 forward | N/A | PCR Primer | 5′−3′: ACCAGAGACGGAAATCCATCGCTC |
| Sequence-based reagent | Nestin-creERT2 reverse | N/A | PCR Primer | 5′−3′: TGCCACGACCAAGTGACAGCAATG |
| Sequence-based reagent | Pth1r loxP allele forward | N/A | PCR Primer | 5′−3′: TGGACGCAGACGATGTCTTTACCA |
| Sequence-based reagent | Pth1r loxP allele reverse | N/A | PCR Primer | 5′−3′: ACATGGCCATGCCTGGGTCTGAGA |
| Software, algorithm | Graphpad 8.0 | N/A | Statistical Analysis | Graph preparation |
| Software, algorithm | SPSS, 15.0 | N/A | Statistical Analysis | Statistical analysis |