Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Morpholino information for three lncRNAs.
| Oligo name | Quantity | Production number | Sequence (5'–3') |
|---|---|---|---|
| MSTRG.30533.1 | 300 nmol | 04–13Aug18A | GCTTGATTTGGTTGATTCCTAACTG |
| MSTRG.33365.1 | 300 nmol | 05–13Aug18A | TGGAGTCCACTGACACTGACTGATC |
| ENSDART00000171757 | 300 nmol | 06–13Aug18A | ATACTGCATTCCAAACCTGAATCAG |
