Skip to main content
. 2021 Mar 22;15(3):e0009297. doi: 10.1371/journal.pntd.0009297

Table 1. The repertoire of Echinococcus multilocularis mature miRNAs identified through metacestode development in vitro, their evolutionary origin and conservation.

miRNA name Mature sequence (5’-3’)a Family Evolutionary originb Conservation in selected Phylac Conservation in selected Platyhelminthesd
Egr Eca Tcr Mvo Hmi Sma Gsa Sme
emu-bantam-3p UGAGAUCGCGAUUACAGCUGAU Bantam P +/+/+/–/– + + + + + + + +
emu-let-7-5p UGAGGUAGUGUUUCGAAUGUCU let-7 B +/+/+/+/– + + + + + + + +
emu-miR-1-3p UGGAAUGUUGUGAAGUAUGU mir-1 B +/+/+/+/– + + + + + + + +
emu-miR-2a-3p AAUCACAGCCCUGCUUGGAACC mir-2 P +/+/+/–/– + + + + + + + +
emu-miR-2b-3p UAUCACAGCCCUGCUUGGGACA + + + + + + + +
emu-miR-2c-3p __UCACAGCCAAUAUUGAUGAA + + + + + + + +
emu-miR-7a-5p UGGAAGACUGGUGAUAUGUUGU mir-7 B +/+/+/+/– + + + + + + + +
emu-miR-7b-5p UGGAAGACUUGUGAUUAGAUUGUU + + + + + + + +
emu-miR-8-3p UAAUACUGUUCGGUUAGGACGCC mir-8 B +/+/+/+/– + + - - - + + +
emu-miR-9-5p UCUUUGGUUAUCUAGCUGUGUG mir-9 B +/+/+/+/– + + + + + - + +
emu-miR-10-5p CACCCUGUAGACCCGAGUUUGA mir-10 E +/+/+/+/+ + + + + + + + +
emu-miR-31-5p UGGCAAGAUACUGGCGAAGCUGA mir-31 B +/+/+/+/– + + + + + + + +
emu-miR-36a-3p UCACCGGGUAGACAUUCCUUGC mir-36 P +/+/+/–/– + + + + + + + +
emu-miR-36b-3p UCACCGGGUAGUUAUUACGCCU + + + + + + + +
emu-miR-61-3p UGACUAGAAAGAGCACUCACAUC mir-61/279 P +/+/+/–/– + + + + + + + +
emu-miR-71-5p UGAAAGACGAUGGUAGUGAGA mir-71 B +/+/+/–/– + + + + + + + +
emu-miR-87-3p GUGAGCAAAGUUUCAGGUGU mir-87 P +/+/+/–/– + + + + + - + +
emu-miR-96-5p AUUGGCACUUUUGGAAUUGUC mir-96 B +/+/+/+/– + + + + + + + +
emu-miR-124a-3p UAAGGCACGCGGUGAAUGCCA mir-124 B +/+/+/+/– + + + + + + + +
emu-miR-124b-3p UAAGGCACGCGGUGAAUACC + + + + + + + +
emu-miR-125-5p UCCCUGAGACCCUAGAGUUGUC mir-125 B +/+/+/+/– + + + + + + + +
emu-miR-133-3p UUGGUCCCCAUUAACCAGCCGCC mir-133 B +/+/+/+/– + + + + + - - +
emu-miR-153-3p UUGCAUAGUCUCAUAAGUGCCA mir-153 B +/+/+/+/– + + + + + - + +
emu-miR-184-3p GGGACGGAAGUCUGAAAGGUUU mir-184 B +/+/+/+/– + + + + + - + +
emu-miR-190-5p AGAUAUGUUUGGGUUACUUGGUGCU mir-190 B +/+/+/+/– + + + + + + + +
emu-miR-219-5p UGAUUGUCCAUUCGCAUUUCUUG mir-219 B +/-/+/+/– + + + + + + + +
emu-miR-277a-3p UAAAUGCAUUUUCUGGCCCGUA mir-277/4989 P +/+/+/–/– + + + + + + + +
emu-miR-277b-3pe UAAAUGCAAAAUAUCUGGUUAUG + + + + + + + +
emu-miR-4989-3p AAAAUGCACCAACUAUCUGAGA + + + + + + + +
emu-miR-281-3p UGUCAUGGAGUUGCUCUCU mir-281 B +/+/+/+/– + + + + + + + +
emu-miR-307-3p UCACAACCUACUUGAUUGAGGGG mir-307/67 P +/+/+/–/– + + + + + - + +
emu-miR-745-3p UGCUGCCUGGUAAGAGCUGUGA mir-745/22 B +/–/+/+/– + + + + + + - +
emu-miR-1992-3p UCAGCAGUUGUACCAUUGAAAU mir-1992 L +/–/–/–/– + + + - - - + +
emu-miR-2162-3p UAUUAUGCAACUUUUCACUCC mir-2162/1993 P +/+/+/–/– + + + + + + + +
emu-miR-3479a-3p UAUUGCACGUUCUUUCGCCAUC mir-3479/92 B +/+/+/+/–/ + + + + + + - +
emu-miR-3479b-3p GAUUGCACUACCCAUCGCCCAC + + + + + + - +
emu-miR-10293-3pf UAAUUCGAGUCAACAGGGUCGUU mir-10293 Pl –/–/–/–/– + + + + - + + +

a Seed sequences (nt 2–8) are shown in bold.

b P: Protostomia; B: Bilateria, E: Eumetazoa; L: Lophotrochozoa; Pl: Platyhelminthes.

c Annelida/Nematoda/Arthrophoda/Vertebrata/Cnidaria. (Vertebrata is a Subphylum).

d Egr: Echinococcus granulosus, Eca: Echinococcus canadensis, Tcr: Taenia crassiceps, Mvo: Mesocestoides vogae, Hmi: Hymenolepis microstoma, Sma: Schistosoma mansoni, Gsa: Gyrodactylus salaris, Sme: Schmidtea mediterranea.

e Previously reported as miR-new-2-3p by Cucher et al. (2015).

f Previously reported as miR-new-1-3p by Cucher et al. (2015).