Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (D. melanogaster) | Rab2 | FlyBase ID:FBgn0014009 | Sequence location: 2R:6,696,739.6,699,469 [+] | |
| Gene (D. melanogaster) | Rab4 | FlyBase ID:FBgn0016701 | Sequence location: 2R:17,573,462.17,574,979 [+] | |
| Gene (D. melanogaster) | Rab9 | FlyBase ID:FBgn0032782 | Sequence location: 2L:19,432,574.19,435,841 [+] | |
| Gene (D. melanogaster) | Rab10 | FlyBase ID:FBgn0015789 | Sequence location: X:20,251,338.20,254,691 [+] |
|
| Gene (D. melanogaster) | Rab14 | FlyBase ID:FBgn0015791 | Sequence location: 2L:14,355,145.14,358,764 [+] | |
| Gene (D. melanogaster) | Rab18 | FlyBase ID:FBgn0015794 | Sequence location: X:5,670,827.5,671,812 [-] | |
| Gene (D. melanogaster) | Rab19 | FlyBase ID:FBgn0015793 | Sequence location: 3L:8,297,018.8,298,506 [+] | |
| Gene (D. melanogaster) | Rab21 | FlyBase ID:FBgn0039966 | Sequence location: X:23,012,140.23,013,409 [-] | |
| Gene (D. melanogaster) | Rab23 | FlyBase ID:FBgn0037364 | Sequence location: 3R:5,680,054.5,685,434 [-] | |
| Gene (D. melanogaster) | Rab26 | FlyBase ID:FBgn0086913 | Sequence location: 3L:21,318,774.21,335,027 [+] | |
| Gene (D. melanogaster) | Rab30 | FlyBase ID:FBgn0031882 | Sequence location: 2L:7,030,493.7,032,606 [-] | |
| Gene (D. melanogaster) | Rab35 | FlyBase ID:FBgn0031090 | Sequence location: X:20,155,766.20,159,872 [-] | |
| Gene (D. melanogaster) | Rab39 | FlyBase ID:FBgn0029959 | Sequence location:X:7,734,923.7,736,756 [+] | |
| Gene (D. melanogaster) | Rab40 | FlyBase ID:FBgn0030391 | Sequence location: X:12,459,796.12,463,112 [-] | |
| Gene (D. melanogaster) | RabX1 | FlyBase ID:FBgn0015372 | Sequence location: 2R:23,519,839.23,523,613 [-] | |
| Gene (D. melanogaster) | RabX4 | FlyBase ID:FBgn0051118 | Sequence location: 3R:24,826,665.24,828,409 [-] | |
| Gene (D. melanogaster) | RabX6 | FlyBase ID: FBgn0035155 | Sequence location: 3L:690,517.691,951 [+] | |
| Strain, strain background (D. melanogaster) | yw | yw;; | ||
| Strain, strain background (D. melanogaster) | w1118 | w1118;; | ||
| Genetic reagent (D. melanogaster) | rab30- Gal4-KI, UAS-YFP-Rab30WT | Hiesinger lab stock | ||
| Genetic reagent (D. melanogaster) | rab3-Df | Bloomington Drosophila Stock Center (BDSC) | BDSC:8909 | Deficiency line for rab3 |
| Genetic reagent (D. melanogaster) | rab4-Df | Bloomington Drosophila Stock Center | BDSC:38465 | Deficiency line for rab4 |
| Genetic reagent (D. melanogaster) | rab9-Df | Bloomington Drosophila Stock Center | BDSC:7849 | Deficiency line for rab9 |
| Genetic reagent (D. melanogaster) | rab10-Df | Bloomington Drosophila Stock Center | BDSC:29995 | Deficiency line for rab10 |
| Genetic reagent (D. melanogaster) | rab14-Df | Bloomington Drosophila Stock Center | BDSC:7518 | Deficiency line for rab14 |
| Genetic reagent (D. melanogaster) | rab19-Df | Bloomington Drosophila Stock Center | BDSC:7591 | Deficiency line for rab19 |
| Genetic reagent (D. melanogaster) | rab32-Df | Bloomington Drosophila Stock Center | BDSC:23664 | Deficiency line for rab32 |
| Genetic reagent (D. melanogaster) | rab39-Df | Bloomington Drosophila Stock Center | BDSC:26563 | Deficiency line for rab39 |
| Genetic reagent (D. melanogaster) | rab40-Df | Bloomington Drosophila Stock Center | BDSC:26578 | Deficiency line for rab40 |
| Genetic reagent (D. melanogaster) | rabX1-Df | Bloomington Drosophila Stock Center | BDSC:26513 | Deficiency line for rabX1 |
| Genetic reagent (D. melanogaster) | rabX4-Df | Bloomington Drosophila Stock Center | BDSC:25024 | Deficiency line for rabX4 |
| Genetic reagent (D. melanogaster) | rabX6-Df | Bloomington Drosophila Stock Center | BDSC:8048 | Deficiency line for rabX6 |
| Genetic reagent (D. melanogaster) | EYFP-Rab3 | Dunst et al., 2015 | FlyBase ID:FBst0062541; BDSC:62541 | FlyBase Genotype: w1118; TI{TI}Rab3EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab4 | Dunst et al., 2015 | FlyBase ID:FBst0062542; BDSC:62542 |
FlyBase Genotype: y1w1118; TI{TI}Rab4EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab9 | Dunst et al., 2015 | FlyBase ID:FBst0062547; BDSC:62547 |
FlyBase Genotype: w1118; TI{TI}Rab9EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab19 | Dunst et al., 2015 | FlyBase ID:FBst0062552; BDSC:62552 |
FlyBase Genotype: w1118; TI{TI}Rab19EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab21 | Dunst et al., 2015 | FlyBase ID:FBst0062553; BDSC:62553 |
FlyBase Genotype:y1 w1118 TI{TI}Rab21EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab23 | Dunst et al., 2015 | FlyBase ID:FBst0062554; BDSC:62554 |
FlyBase Genotype: y1 w1118; TI{TI}Rab23EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab26 | Dunst et al., 2015 | FlyBase ID:FBst0062555; BDSC:62555 |
FlyBase Genotype: y1 w1118; TI{TI}Rab26EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab27 | Dunst et al., 2015 | FlyBase ID:FBst0062556; BDSC:62556 |
FlyBase Genotype: y1 TI{TI}Rab27EYFP w1118 |
| Genetic reagent (D. melanogaster) | EYFP-Rab32 | Dunst et al., 2015 | FlyBase ID:FBst0062558; BDSC:62558 |
FlyBase Genotype: w1118; TI{TI}Rab32EYFP |
| Genetic reagent (D. melanogaster) | EYFP-Rab40 | Dunst et al., 2015 | FlyBase ID:FBst0062561; BDSC:62561 |
FlyBase Genotype: y1 w1118 TI{TI}Rab40EYFP |
| Genetic reagent (D. melanogaster) | EYFP-RabX1 | Dunst et al., 2015 | FlyBase ID:FBst0062562; BDSC:62562 |
FlyBase Genotype: w1118; TI{TI}RabX1EYFP |
| Genetic reagent (D. melanogaster) | EYFP-RabX4 | Dunst et al., 2015 | FlyBase ID:FBst0062563; BDSC:62563 |
Heterozygous flies used; FlyBase Genotype: w1118; TI{TI}RabX4EYFP |
| Genetic reagent (D. melanogaster) | EYFP-RabX6 | Dunst et al., 2015 | FlyBase ID:FBst0062565; BDSC:62565 |
FlyBase Genotype: w1118; TI{TI}RabX6EYFP |
| Genetic reagent (D. melanogaster) | rab2 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab4 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab9 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab10 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab14 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab18 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab19 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab21 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab23 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab26 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab30 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab35 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab39 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab40 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rabX1 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rabX4 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| genetic reagent (D. melanogaster) | rabX6 | This paper | Fly stock maintained in Hiesinger lab; see Materials and methods | |
| Genetic reagent (D. melanogaster) | rab1 | Thibault et al., 2004 | FlyBase ID:FBst0017936; BDSC:17936 |
FlyBase Genotype: w1118; PBac{RB}Rab1e01287/TM6B, Tb1 |
| Genetic reagent (D. melanogaster) | rab3 | Graf et al., 2009 | FlyBase ID:FBst0078045; BDSC:78045 |
FlyBase Genotype: w*; Rab3rup |
| Genetic reagent (D. melanogaster) | rab5 | Wucherpfennig et al., 2003 | FlyBase ID:FBal0182047 | w; Rab52 P{neoFRT}40A/CyO; |
| Genetic reagent (D. melanogaster) | rab6 | Purcell and Artavanis-Tsakonas, 1999 | FlyBase ID:FBst0005821; BDSC:5821 |
FlyBase Genotype: w*; Rab6D23D/CyO; ry506 |
| Genetic reagent (D. melanogaster) | rab7 | Cherry et al., 2013 | FlyBase ID:FBal0294205 | Fly stock maintained in Hiesinger lab; “;Sp/CyO; P{neoFRT}82B, Rab7Gal4-KO
/TM3’ |
| Genetic reagent (D. melanogaster) | rab8 | Giagtzoglou et al., 2012 | FlyBase ID:FBst0026173; BDSC:26173 |
FlyBase Genotype: Rab81 red1 e4/TM6B, Sb1 Tb1 ca1 |
| Genetic reagent (D. melanogaster) | rab11 | Bellen et al., 2004 | FlyBase ID:FBst0042708; BDSC:42708 |
FlyBase Genotype: w*; P{EP}Rab11EP3017/TM6B, Tb1 |
| Genetic reagent (D. melanogaster) | rab27 | Chan et al., 2011 | Fly stock maintained in Hiesinger lab; rab27Gal4-KO;; | |
| Genetic reagent (D. melanogaster) | rab32 | Ma et al., 2004 | FlyBase ID:FBst0000338; BDSC:338 |
FlyBase Genotype: Rab321 |
| Genetic reagent (D. melanogaster) | lGMR-Gal4, UAS-white RNAi | Hiesinger lab stock | Fly stock maintained in Hiesinger lab; long version of GMR | |
| Genetic reagent (D. melanogaster) | UAS-YFP-Rab26WT | Zhang et al., 2007 | BDSC:23245 | YFP-tagged, wild type form of Rab26 |
| Genetic reagent (D. melanogaster) | UAS-YFP-Rab26CA | Zhang et al., 2007 | BDSC:9809 | YFP-tagged, constitutively active form of Rab26 |
| Genetic reagent (D. melanogaster) | UAS-YFP-Rab26DN | Zhang et al., 2007 | BDSC:9807 | YFP-tagged, dominant negative form of Rab26 |
| Genetic reagent (D. melanogaster) | elav-Gal4 | Bloomington Drosophila Stock Center | FlyBase ID:FBst0008765; BDSC:8765 |
FlyBase Genotype: P{GAL4-elav.L}2/CyO |
| Genetic reagent (D. melanogaster) | sGMR-Gal4 | Bloomington Drosophila Stock Center | FlyBase ID:FBst0001104; BDSC:1104 |
FlyBase Genotype: w*; P{GAL4-ninaE.GMR}12 |
| Genetic reagent (D. melanogaster) | UAS-Rab26 RNAi | Vienna Drosophila Resource Center (VDRC) | VDRC:101330 | Rab26 RNAi line KK107584 |
| Genetic reagent (D. melanogaster) | rab26exon1-Gal4 | Chan et al., 2011 | Fly stock is maintained in Hiesinger lab | |
| Genetic reagent (D. melanogaster) | UAS-CD4-tdGFP | Bloomington Drosophila Stock Center | FlyBase ID:FBst0035839; BDSC:35839 |
FlyBase Genotype: y1w*; P{UAS-CD4-tdGFP}8 M2 |
| Genetic reagent (D. melanogaster) | 31C06-Gal4 (L4-Gal4) | Bloomington Drosophila Stock Center | FlyBase ID:FBst0049883; BDSC:49883 |
FlyBase Genotype: w1118; P{GMR31C06-GAL4}attP2 |
| Genetic reagent (D. melanogaster) | Lawf1-Split-Gal | Tuthill et al., 2013 | R11G01AD attP40; R17C11DBD attP2; ‘SS00772’ | |
| Genetic reagent (D. melanogaster) | Lawf2-Split-Gal | Tuthill et al., 2013 | R11D03AD attP40; R19C10DBD attP2; ‘SS00698’ | |
| Genetic reagent (D. melanogaster) | UAS-rye RNAi; UAS-Dicer2 | Gift from Amita Sehgal | Dα4 receptor subunit RNAi line | |
| Genetic reagent (D. melanogaster) | rdgC306 | Bloomington Drosophila Stock Center | FlyBase ID:FBst0003601; BDSC:3601 |
FlyBase Genotype: w1118; rdgC306 kar1 ry1/TM3, Sb1 Ser1 |
| Antibody | Anti-Rab5 (Rabbit polyclonal) | Abcam (Cambridge, UK) | Cat #: ab31261; RRID: AB_882240 | IHC (1:1000) |
| Antibody | Anti-Rab7 (Rabbit polyclonal) | Gift from Patrick Dolph | IHC (1:1000) | |
| Antibody | Anti-Rab11 (Mouse monoclonal) | BD Biosciences (San Jose, CA, USA) | clone47; RRID:AB_397983 | IHC (1:500) |
| Antibody | Anti-Rab26 (Guinea pig polyclonal) | This paper | See Materials and methods; IHC (1:2000); WB (1:1000) | |
| Antibody | Anti-Syt1 (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA) | 3H2 2D7; RRID:AB_528483 | IHC (1:500) |
| Antibody | Anti-GABARAP+GABARAPL1+GABARAPL2 (Atg8) (Rabbit monoclonal) | Abcam (Cambridge, UK) | Cat #: ab109364; RRID:AB_10861928 | IHC (1:100) |
| Antibody | Anti-Syx7/Avalanche (Rabbit polyclonal) | Gift from Helmut Kramer | IHC (1:1000) | |
| Antibody | Anti-Hrs (Guinea pig polyclonal) | Gift from Hugo Bellen | IHC (1:300) | |
| Antibody | Anti-HRP (Rabbit polyclonal) | Jackson ImmunoResearch Laboratories (West Grove, PA, USA) | RRID:AB_2314648 | IHC (1:500) |
| Antibody | Anti-DPAK (Rabbit polyclonal) | IHC (1:2000) | ||
| Antibody | Anti-Dα7 (Rat polyclonal) | Gift from Hugo Bellen | IHC (1:2000) | |
| Antibody | Anti-nCadherin (Rat monoclonal) | Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA) | DN-Ex #8; RRID:AB_528121 |
IHC (1:100) |
| Antibody | Anti-V100 (Guinea pig polyclonal) | Hiesinger et al., 2005 | IHC (1:1000) | |
| Antibody | Anti-CSP (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA) | DCSP-2 (6D6); RRID:AB_528183 | IHC (1:50) |
| Antibody | Anti-ChAT (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA) | ChAT4B1; RRID:AB_528122 | IHC (1:100) |
| Antibody | Anti-nc82 (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA) | RRID: AB_2314866 | IHC (1:20) |
| Antibody | Anti-ebony (Rabbit polyclonal) | IHC (1:200) | ||
| Antibody | Anti-Chaoptin (Mouse monoclonal) | Developmental Studies Hybridoma Bank (DSHB) (Iowa City, IA, USA) | 24B10; RRID: AB_528161 | IHC (1:50) |
| Antibody | Anti-DCP-1 (Rabbit polyclonal) | Cell Signaling Technology (Danvers, MA, USA) | Asp216; Cat#: 9578; RRID:AB_2721060 | IHC (1:100) |
| Antibody | DyLight 405 AffiniPure Donkey Anti-Mouse igG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 715-475-150; RRID:AB_2340839 | IHC (1:500) |
| Antibody | Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 115-545-003; RRID: AB_2338840 | IHC (1:500) |
| Antibody | Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 115-545-166; RRID: AB_2338852 | Minimal cross-reactive; IHC (1:500) |
| Antibody | Alexa Fluor 488 AffiniPure Goat Anti-Rat IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 112-545-167; RRID: AB_2338362 | Minimal cross-reactive; IHC (1:500) |
| Antibody | Alexa Fluor 488 AffiniPure Goat Anti-Guinea Pig IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 106-545-003; RRID: AB_2337438 | IHC (1:500) |
| Antibody | Cy3 AffiniPure Goat Anti-Rabbit IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 111-165-003; RRID: AB_2338000 | IHC (1:500) |
| Antibody | Alexa Fluor 647 AffiniPure Goat Anti-Rabbit IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 111-605-045; RRID: AB_2338075 | IHC (1:500) |
| Antibody | Alexa Fluor 647 AffiniPure Goat Anti-Rat IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 112-605-003; RRID: AB_2338393 | IHC (1:500) |
| Antibody | Goat Anti-Guinea pig IgG H&L (Cy5) | Abcam (Cambridge, UK) | Cat. #: ab102372; RRID: AB_10710629 | IHC (1:500) |
| Antibody | Cy5 AffiniPure Goat Anti-Mouse IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 115-175-166; RRID: AB_2338714 |
Minimal cross-reactive; IHC (1:500) |
| Antibody | Cy5 AffiniPure Goat Anti-Rat IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 112-175-167; RRID: AB_2338264 | Minimal cross-reactive; IHC (1:500) |
| Antibody | Peroxidase AffiniPure Goat Anti-Guinea Pig IgG (H+L) | Jackson ImmunoResearch (West Grove, PA, USA) | 106-035-003; RRID: AB_2337402 | WB (1:5000) |
| Sequence-based reagent | rab2 | This paper | PCR primers | Fwd: 5’-TGGCCACACTGTCGCTAGCC; Rev: 5’-CGCCTCCTCTACGTTGGCAG |
| Sequence-based reagent | rab3 | This paper | PCR primers | Fwd: 5’-ACACTGAGGCGAGCTTACGC; Rev: 5’-CTACTACCGAGGAGCGATGGG |
| Sequence-based reagent | rab4 | This paper | PCR primers | Fwd: 5’- GGTTTTGATCGTGTCCTGCG; Rev: 5’-AGACAACTCTTACCGCTGCC |
| Sequence-based reagent | rab9 | This paper | PCR primers | Fwd: 5’- GGCACTATGACGAACATGCGG; Rev: 5’-tttgcagcactgggaaatccg |
| Sequence-based reagent | rab10 | This paper | PCR primers | Fwd: 5’- atatctcttgtcacctgcgcc; Rev: 5’-cgaccaccatccatcgttcgg |
| Sequence-based reagent | rab14 | This paper | PCR primers | Fwd: 5’-gggGCCAGTTCGAGAAAGGG; Rev: 5’-CACGAGCACTGATCCTTGGC |
| Sequence-based reagent | rab18 | This paper | PCR primers | Fwd: 5’- AAACAAAGCAGCAAGGTGGC; Rev: 5’-CTCCTCGTCGATCTTGTTGCC |
| Sequence-based reagent | rab19 | This paper | PCR primers | Fwd: 5’- CCAGTTAACGGCCAGAACGG; Rev: 5’-TTGCCTCTCTGAGCATTGCC |
| Sequence-based reagent | rab21 | This paper | PCR primers | Fwd: 5’- CAATGGGAACGGCTAAATGCC; Rev: 5’-caacatttaTCGCCGAGTGCC |
| Sequence-based reagent | rab23 | This paper | PCR primers | Fwd: 5’- CACCTGCCGGCTTAGATGCG; Rev: 5’-GAGATATCGGAACCGGCCCG |
| Sequence-based reagent | rab26 | This paper | PCR primers | Fwd: 5’- CGATGAAGTGGACATGCACCC; Rev: 5’-tgcacttgaacttcactggcg |
| Sequence-based reagent | rab30 | This paper | PCR primers | Fwd: 5’- ACCCAGCGACTCAAAAACCC; Rev: 5’-GCTGCACAGTTTCCAGATCCG |
| Sequence-based reagent | rab32 | This paper | PCR primers | Fwd: 5’-GTAGACACGGGTCATGTTGCC; Rev: 5’-accagcaaatctcagtgcgg |
| Sequence-based reagent | rab35 | This paper | PCR primers | Fwd: 5’- CGAATCGTAAGCCAAGAACCC; Rev: 5’-ACTAATGGTGACGCACTGGC |
| Sequence-based reagent | rab39 | This paper | PCR primers | Fwd: 5’- TAACAACCACCAGCGACAGCC; Rev: 5’-CGTATACCTCGTGTGACTGGC |
| Sequence-based reagent | rab40 | This paper | PCR primers | Fwd: 5’- caatgagtaaacccctagcgg; Rev: 5’-TGGGTATGGGTATGGTATGGG |
| Sequence-based reagent | rabX1 | This paper | PCR primers | Fwd: 5’- GTGCCCAAGAAATCAGACGC; Rev: 5’-AGTCAGATGGGCTTAGAGCG |
| Sequence-based reagent | rabX4 | This paper | PCR primers | Fwd: 5’- CTGTAACCGAAAACCTCCGC; Rev: 5’-CAACTTGCTCAGGTTCTGCG |
| Sequence-based reagent | rabX6 | This paper | PCR primers | Fwd: 5’- GTCGCACTGTTGTTGTCGCC; Rev: 5’-CTCTGCGTGAGCATTGAGCC |
| Sequence-based reagent | Reverse primer in Gal4-region | This paper | PCR primers | 5’-CGGTGAGTGCACGATAGGGC |
| Sequence-based reagent | Second reverse primer in Gal4-region | This paper | PCR primers | 5’-CAATGGCACAGGTGAAGGCC |
| Sequence-based reagent | Reverse primer in RFP-region | This paper | PCR primers | 5’- GCTGCACAGGCTTCTTTGCC |
| Sequence-based reagent | Second reverse primer in RFP-region | This paper | PCR primers | 5’- ACAATCGCATGCTTGACGGC |
| Sequence-based reagent | Forward primer in RFP-region | This paper | PCR primers | 5’- GGCTCTGAAGCTGAAAGACGG |
| Sequence-based reagent | Forward primer in dsRed-region | This paper | PCR primers | 5’- ATGGTTACAAATAAAGCAATAGCATC |
| Sequence-based reagent | Reverse primer behind right-arm of inserted dsRed-cassette | This paper | PCR primers | 5’-AAACCACAGCCCATAGACG |
| Commercial assay or kit | SapphireAmp Fast PCR Master Mix | Takara Bio Group | Cat. #: RR350A |
|
| Commercial assay or kit | Phusion High-Fidelity PCR kit | Thermo Fisher Scientific Inc (Waltham, MA, USA) | Cat. #: F553S |
|
| Commercial assay or kit | NucleoSpin Gel and PCR Clean–up | Macherey-Nagel (Düren, Germany) | Cat. #: 740609.50 | Mini kit for gel extraction and PCR clean-up |
| Software, algorithm | ImageJ | National Institutes of Health (NIH) | https://imagej.nih.gov/ij/ | |
| Software, algorithm | Imaris | Bitplane (Zurich, Switzerland) | https://imaris.oxinst.com/packages | |
| Software, algorithm | Amira | Thermo Fisher Scientific Inc (Waltham, MA, USA) | https://www.thermofisher.com/de/de/home/industrial/electron-microscopy/electron-microscopy-instruments-workflow-solutions/3d-visualization-analysis-software.html | |
| Software, algorithm | Adobe Photoshop | Adobe Inc (San Jose, CA, USA) | https://www.adobe.com/products/photoshop.html | |
| Software, algorithm | Adobe Illustrator | Adobe Inc (San Jose, CA, USA) | https://www.adobe.com/products/illustrator.html | |
| Software, algorithm | RStudio | RStudio Inc (Boston, MA, USA) | https://rstudio.com/products/rstudio/ | |
| Software, algorithm | GraphPad Prism | GraphPad Software Inc (San Diego, CA, USA) | https://www.graphpad.com/scientific-software/prism/ | |
| Software, algorithm | AxoScope | Molecular Devices LLC. (San Jose, CA, USA) | https://www.moleculardevices.com/ | |
| Software, algorithm | SnapGene | GSL Biotech LLC (Chicago, IL, USA) | https://www.snapgene.com/ | |
| Other | Toto-3 stain | Thermo Fisher Scientific Inc (Waltham, MA, USA) | Cat. #: T3604 | TOTO-3 Iodide (642/660); IHC (1:1000) |
| Other | Phalloidin stain | Abcam (Cambridge, UK) | Cat. #: ab176752 | Phalloidin-iFluor 405; IHC (1:250) |
| Other | SDS-polyacrylamide Gel | Bio-Rad Laboratories, Inc (Hercules, CA, USA) | Cat. #: 4561083 | 4–15% Mini-PROTEAN TGX Precast Gels |
| Other | PVDF membrane | Bio-Rad Laboratories, Inc (Hercules, CA, USA) | Cat. #: 162–0177 | |
| Other | Clarity Western ECL Substrate | Bio-Rad Laboratories, Inc (Hercules, CA, USA) | Cat. #: 170–5060 | |
| Other | Insect needles | Entomoravia (Slavkov u Brna, Czech Republic) | https://entomoravia.eu/ | Austerlitz insect needles; ø 0.1 mm |