Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of primers.
| Target | Species | Forward Primer | Reverse Primer |
|---|---|---|---|
| p65 | Human | ttcccgatctgagtccaggt | gcttgtctcgggtttctgga |
| Nanog | Human | atgcctcacacggagactgt | aagtgggttgtttgcctttg |
| Sox2 | Human | ctccgggacatgatcagc | ggtagtgctgggacatgtgaa |
| Rex1 | Human | cgcaatcgcttgtcctcagagt | gctctcaacgaacgctttccca |
| Oct4 | Human | ctcctggagggccaggaatc | atatacacaggccgatgtgg |
| β -actin | Human | agagctacgagctgcctgac | ggatgccacaggactcca |
