Skip to main content
. 2021 Mar 17;21:262–273. doi: 10.1016/j.omtm.2021.03.008

Table 2.

Results of off-target sequence analysis of top five off-target candidates determined by the CFD score of TRIM5 gRNA

Position Sequence (5′→3′) No. of mismatches CFD off-target score KO iPSC #1 KO iPSC #2 KO iPSC #3
TRIM5 on-target site chr14:67658119–110054350 CTACGACAAAACCAACGTCT CGG 1.0000 −14 bp, −14 bp −5 bp, −14 bp −14 bp, −14 bp

Potential off-target sites chr4:103904324–103904346 CTATAATAAAACCAACATCT TGG 4 0.525778 WT WT WT
chr2:76073316–76073338 CTAAGGCAAAAACAACATCT AGG 4 0.401003 WT WT WT
chr2:98763243–98763265 CTGCCACAAACCCAACATCT TGG 4 0.179259 WT WT WT
chr7:42594298–42594320 ATAAGATAAAACCAACGTCT GAG 3 0.177388 WT WT WT
chr9:104127964–104127986 CTACAAAGAAACCAACTTCT AGG 4 0.119167 WT WT WT

CFD, cutting frequency determination; WT, wild-type.