| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial and virus strains | ||
| BL21(DE3) | Sigma-Aldrich | Cat. #CMC0014 |
| BL21(DE3) Codon Plus (RIL) | Agilent | Cat. # 230245 |
| Chemicals, peptides, and recombinant proteins | ||
| Protein Thermal Shift Dye for protein thermal shift assay | Applied Biosystems | Cat. # 4461146 |
| Uridine 5′(α-thio) triphosphate | Jenna Bioscience | Cat. # NU-411S |
| Acrylamide:bis-acrylamide solution | Bio-Rad Laboratories | Cat. # 161-0154 |
| 2× Laemmli sample buffer | Bio-Rad Laboratories | Cat. # 161-0737 |
| Urea | Sigma-Aldrich | Cat. # U5378 |
| Ammonium persulfate | Sigma-Aldrich | Cat. # A3678 |
| TEMED | Sigma-Aldrich | Cat. # T9281 |
| ATP, GTP, and UTP | Thermo Scientific | Cat. # R0481 |
| 3′-dCTP | TriLink BioTechnologies | Cat. # N-3003 |
| α-32P-GTP | PerkinElmer | Cat. # BLU506H250UC |
| Poly(ethyleneimine), average Mw ˜1300 Da, 50% w/v | Sigma | Cat. # 482595-100ML |
| Remel™ LB Agar, Miller | Thermo Fisher Scientific | Cat. # R453632 |
| Plasmid pRK793 for expressing tobacco etch virus (TEV) protease | Kapust et al., 2001 | Addgene.org plasmid # 8827 |
| Deposited data | ||
| Yeast mitochondrial ΔN100 y-mtRNAP /MTF1/dsDNA, pre-initiation complex | This paper | PDB 6YMV |
| Cryo-EM map for above | This paper | EMD-10845 |
| Yeast mitochondrial ΔN100 y-mtRNAP /MTF1/dsDNA/RNA/UTPαS, initiation complex | This paper | PDB 6YMW |
| Cryo-EM map for above | This paper | EMD-10846 |
| Original source data | This paper | https://dx.doi.org/10.17632/vtd45jkx6v.3 |
| Oligonucleotides | ||
| Modified yeast mitochondrial 15S promoter nontemplate strand 5′ -CGAATAAGTATTGATATAAGTAATAGATAATGC |
IDT | N/A |
| Modified yeast mitochondrial 15S promoter template 5′ -GCATTATCTACCGACAATATCAATACTTATTCG |
IDT | N/A |
| Yeast mitochondrial 21S rRNA promoter template 5′ -GGTATTTCAAATCTATTATTCTACTTTTTACTACTT ATATATATAATAATAATAATA |
IDT | N/A |
| Yeast mitochondrial 21S rRNA promoter nontemplate 5′ -TATTATTATTATTATATATATAAGTAG TAAAAAGTAGAATAATAGATTTGAAATACC |
IDT | N/A |
| RNA sequence (primer strand): 5′ pppGpG 3′ | TriLink BioTechnologies | Cat. # O-31011 |
| Recombinant DNA | ||
| Plasmid pTrcHisC for expressing yeast MTF1 | Tang et al., 2009 | N/A |
| Plasmid ProEXHTb for expressing yeast ΔN100 y-mtRNAP |
Paratkar et al., 2011 | N/A |
| Software and algorithms | ||
| PHENIX 1.16 | Liebschner et al., 2019 | phenix-online.org |
| RELION 3.0.8 | Zivanov et al., 2018 | https://www3.mrc-lmb.cam.ac.uk/relion/index.php/Main_Page |
| CTFFIND-4 | Rohou and Grigorieff, 2015 | https://grigoriefflab.umassmed.edu/ctffind4 |
| Scipion | de la Rosa-Trevin et al., 2016 | http://scipion.i2pc.es |
| Curves+ | (Blanchet et al., 2011) | https://bisi.ibcp.fr/tools/curves_plus/index.html |
| MotionCor2 (included in RELION 3.0.8) | (Zheng et al., 2017) | https://emcore.ucsf.edu/ucsf-motioncor2 |
| Coot 0.8.2 | Emsley and Cowtan, 2004 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ |
| PyMOL | Schrödinger, LLC. | https://pymol.org/2/ |
| Chimera | (Pettersen et al., 2004) | https://www.cgl.ucsf.edu/chimera/download.html |
| DYNAMICS 7.10.0.23 | Wyatt Technology | N/A |
| ResMap | Kucukelbir et al., 2014 | N/A |
| Other | ||
| Titan Krios 300 keV cryo-electron microscope | FEI/Thermo Fisher | N/A |
| Titan Glacios 200 keV cryo-electron microscope | FEI/Thermo Fisher | N/A |
| PELCO easiGlow Glow Discharge Cleaning System | Ted Pella | N/A |
| EM GP grid plunger | Leica | N/A |
| Quantifoil® R 1.2/1.3 200 Cu | Quantifoil | Q42272 |
| WhatmanTM filter paper, grade 1 | GE Healthcare | 1001-055 |
| Äkta pure 25 L1 | GE Healthcare | 29018225 |
| miniDAWN TREOS | Wyatt Technology | N/A |
| DynaPro NanoStar DLS | Wyatt Technology | N/A |
| Optilab T-rEX | Wyatt Technology | N/A |
| NanoDropTM One UV-VIS Spectrophotometer | Thermo Fisher | N/A |
| Amicon® Ultra-4 10K centrifugal filter | Merck Millipore | UFC801024 |
| QuantStudio5 qPCR | Thermo Fisher | A28139 |
| Superdex 200 Increase 10/300 GL | GE Healthcare | 28990944 |
| HiTrap DEAE FF column (5 mL) | Cytiva | 17515401 |
| HisTrap HP His tag protein purification column (5 mL) | Cytiva | 17524801 |
| HiTrap Heparin HP affinity column (1 mL) | Cytiva | 17040601 |
| Mini dry bath | Greiner Bio-One | 848060 |
| Microcon 100 kDa with Biomax membrane | Millipore Sigma | MPE100025 |