Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer list
| Primer name | Sequence (5′ → 3′) (underline: PAM sequence) |
|---|---|
| sgRNA target sequence for Antp #1 | GGGTAAGGCATGCCAGGGGCGGG |
| sgRNA target sequence for Antp #2 | GCGACCAGCAGCTCAGGCCCGGG |
| sgRNA target sequence for Ubx #1 | GGCTGCCACGGAGGCGTCGTAGG |
| sgRNA target sequence for Ubx #2 | GGCGTGCACCAGGGCGGTGGCGG |
| Genotype for Antp Fw | AGCTTGCACGAGGGGTACA |
| Genotype for Antp Rv | GAGTACCTGCGACGGAAGC |
| Genotype for Ubx Fw | CACCGTATCCGTTCTGCTG |
| Genotype for Ubx Rv | TCGGGTGACGTTTAATAGGC |
