Reagent/Resource	Reference or Source	Identifier or Catalog Number
Experimental Models
Jurkat cells	This study	J77 clone 20 (short tandem repeat profiling)
293‐LTV cells	Cell Biolabs	LTV‐100
GHOST X4R5	from NIH AIDS Reagent Program	3943
Recombinant DNA
pBR‐NL4‐3 EGFP‐Nef+ (HIV‐1)	Schindler et al (2005)	N/A
pCMV‐VSV‐G	Adgene	Cat#8454
pPAX2	Adgene	Cat#12260
X4GFP (HIV‐1)	Silvin et al (2017)	N/A
pLKO.1 sh luciferase	Sigma‐Aldrich	Mission shRNA SHC007
pLKO.1 sh SERINC3_1 (Homo sapiens)	Sigma‐Aldrich	Mission shRNA, TRCN0000115948
pLKO.1 sh SERINC3_2(H. sapiens)	Sigma‐Aldrich	Mission shRNA, TRCN0000115949
pLKO.1 sh SERINC3_3(H. sapiens)	Sigma‐Aldrich	Mission shRNA, TRCN0000293864
Antibodies
Mouse anti‐human CD63 (clone H5C6)	BD Bioscience	Cat#557305
Mouse anti‐human CD9 (clone MM2/57)	Millipore	Cat#cbl162
Mouse anti‐human CD45 (clone HI30)	BD Bioscience	Cat#557748
Rat anti‐GP96 (clone 9G10)	Stressgen	Cat# ADI‐SPA‐850‐D
Goat anti‐human AChE	Abcam	Cat# ab31276
Mouse anti‐human actin (clone C4)	Millipore	Cat# MAB1501
Rabbit anti‐human syntenin‐1 (clone C2C3)	GeneTex	Cat# GTX10847
Mouse anti‐human CD81 (clone 5A6)	Santa Cruz	Cat# sc‐23692
Rabbit anti‐human SERINC3	Abcam	Cat#ab153748
Mouse anti‐human SPN (clone MEM‐59)	Abcam	Cat#ab9088
Rabbit anti‐ MOV10 (clone EPR14478)	Abcam	Cat# ab189919
Mouse anti‐human ADAM10 (clone 163003)	R&D Systems	Cat# MAB1427
Rabbit anti‐CD3G (clone EPR4517)	Abcam	Cat# ab134096
Mouse anti‐HIV‐1 p24 Monoclonal (183‐H12‐5C)	NIH AIDS reagent program	Cat#1513
HRP‐conjugated goat anti‐rabbit IgG (H + L)	Jackson	Cat#111‐035‐144
HRP conjugated goat anti‐mouse IgG (H + L)	Jackson	Cat#111‐035‐146
HRP‐conjugated donkey anti‐goat IgG (H + L)	Jackson	Cat#705‐035‐147
Rabbit anti‐human CD81 (clone EPR21916)	Abcam	Cat# ab233692
Mouse anti‐human CD63 (clone TS63)	Diaclone	Cat# 857.770.000
Rabbit anti‐mouse	Sigma	Cat#SAB3701080
APC‐conjugated anti‐human CD3 (clone REA 613)	Miltenyi	Cat#130‐113‐697
Oligonucleotides and other sequence‐based reagents
PCR primers GAPDH forward	This study	5′ATGTTCGTCATGGGTGTGAA3′
PCR primers GAPDH reverse	This study	5′ATGTTCGTCATGGGTGTGAA3′
PCR primers SERINC3 forward	This study	5′ATTCTAGCATCCGCACTTCC3′
PCR primers SERINC3 reverse	This study	5′CGAGGCTGTCCATCTTCTTC3′
Chemicals, enzymes and other reagents
RPMI‐1640‐GlutamaxTM medium	Gibco	Cat # 11554516
Penicillin‐Streptomycin	Gibco	Cat#11548876
Fetal bovine serum	Gibco	Batch#42F2567K
DMEM‐GlutamaxTM	Gibco	Cat#11594446
GeneticinTM	Gibco	Cat#11558616
PBS	Gibco	Cat# 11530546
Hygromycin B	Invitrogen	Cat#10687010
LymphoPrepTM tubes	Axis Shield	Cat#11548535
Dynabeads™ Human T‐Activator CD3/CD28 for T Cell Expansion and Activation	Gibco	Cat#111.61D
Hepes	Gibco	Cat#12509079
Non‐essential aminoacids	Gibco	Cat#11140050
Sodium pyruvate	Gibco	Cat#11360070
IL2	R&D Systems	Cat#202‐IL‐010
Puromycin	Invitrogen	Cat#A1113803
TransIT‐293 reagent	Mirus Bio	Cat#MIR27906
Fixable viability dye efluor 780	eBioscience	Cat#65‐0865‐14
OptiprepTM,	Sigma‐Aldrich	Cat#D1556
4x Laemmli Sample buffer	Biorad	Cat#1610747
4–15% Mini‐Protean® TGX Stain‐Free™ gels	Bio‐Rad	Cat#4568083
4–15% Mini‐Protean® TGX Stain‐Free™ gels	Bio‐Rad	Cat#4568086
Immun‐Blot PVDF	Bio‐Rad	Cat#170‐4272
Clarity western ECL substrate	Bio‐Rad	Cat#1705061
Formvar	Agar	Cat#AGR1202
Copper/palladium grids	Agar	Cat#AGG7262PD
Uranyl/acetate	LFG	Cat#6159‐44‐0
Methyl‐cellulose, viscosity:25cP	Sigma	Cat#M6385
Protein A‐gold	CMC, UMC Utrecht, Netherlands
l‐arginine‐13C6	Thermo Scientific	Cat#88210
l‐lysine‐4,4,5,5‐D4	Thermo Scientific	Cat#88437
l‐arginine‐13C6 15N4	Thermo Scientific	Cat#89990
l‐lysine‐13C6 15N2	Thermo Scientific	Cat#88209
Dialyzed Fetal Bovine Serum	Thermo Scientific	Cat#A3382001
SDS	Roth	CN30.3
Tris‐HCl pH 8.0	Sigma	#T6666
Acetone	Fischer Chemical	#A/0600/17
Acetonitrile	Merck	Cat#1.00029.1000
Urea	Sigma	Cat#U5378
Dithiothreitol (DTT)	Euromedex	Cat#EU0006‐B
Idodoacetamide	Sigma	Cat#I6125
LysC	Wako	#129‐02541
Trypsin	Promega	Cat#V5111
Trifluoroacetic acid (TFA),	Sigma	Cat#73645
SDB‐RPS solid phase extraction material	VWR	#66886‐U
50‐cm column with 75‐µm inner diameter, packed in‐house with 1.8‐µm C18 particles	Dr. Maisch GmbH
C18 column (75 μm inner diameter × 2 cm; nanoViper Acclaim PepMapTM 100,	Thermo Scientific	Cat#164535
50 cm × 75 μm C18 column (nanoViper Acclaim PepMapTM RSLC, 2 μm, 100 Å,)	Thermo Scientific	Cat#164942
Centrifugal Filter (MWCO = 100 kDa;)	Sartorius	Cat#VS2061
qEV size‐exclusion columns	Izon	Cat#SP1
Protein A Magnetic Beads	Pierce	Cat#88846
BS3	Thermo Scientific	Cat#A39266
SuperScript II Reverse Transciptase	Thermo Scientific	Cat#18064022
SYBRgreen	ThermoScientific	Cat#A25742
Software
Image Lab v5.2.1	Biorad
Primer3Plus	http://www.bioinformatics.nl/cgi‐bin/primer3plus/primer3plus.cgi
FlowJo software v10	FlowJo LLC
MaxQuant V 1.6.1.13	Cox and Mann (2008)
iTEM, Olympus Soft Imaging Solutions GmbH 5.2
Fiji/ImageJ v2.0.0‐rc‐69/1.52p	https://imagej.net/ImageJ
Python v3.5+ plus packages (holoviz, panel, pandas, network)	https:/www.github.com/JuliaS92/EVProfiler
Other
CD4+ T Cell Isolation Kit	Miltenyi	Cat#130‐096‐533
MACSPlex Exosome Kit, human	Miltenyi	Cat#130‐108‐813
Exosome Isolation Kit CD63, human	Miltenyi	Cat#130‐110‐918
Exosome Isolation Kit CD81, human	Miltenyi	Cat#130‐111‐575
LightCycler®480 Instrument II	LifeScience
RSLCnano system (Ultimate 3000)	Thermo Scientific	Cat#ULTIM3000RSLCNANO
Orbitrap Fusion Tribrid mass spectrometer	Thermo Scientific	Cat#IQLAAEGAAPFADBMBCX
Q Exactive HF Hybrid Quadrupole‐Orbitrap mass spectromete	Thermo Scientific
EASY‐nLC 1000	Thermo Scientific
MACSQuant Analyzer 10	Milteny
Cytek Aurora analyzer
Ultracentrifugue LE80K	Beckman
Ultracentri Optima ‐ L80XP	Beckman
Ultracentrifugue OPTIMA MAX XP	Beckman
Type 45 Ti rotor	Beckman
SW32 Ti rotor	Beckman
TLA‐45 rotor	Beckman
ZetaView PMX‐120 v8.04.02	Particle Metrix