Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | WT C57Bl/6J |
Jackson Laboratories, Bar Harbor, ME | Stock number 000664 | |
| Genetic reagent (M. musculus) | Sun1-/-/Sun2-/-(Sun dKO) | Jackson Laboratories, Bar Harbor, ME | B6;129S6-Sun1tm1Mhan/J Stock No: 012715 crossed to B6;129S6-Sun2tm1Mhan/J Stock No: 012716 |
|
| Cell line (M. musculus) | Primary WT keratinocyte | This paper | Isolated from WT pups | |
| Cell line (M. musculus) | Primary Sun dKO keratinocyte | This paper | Isolated from Sun dKO pups | |
| Cell line (M. musculus) | Integrin β1 null keratinocyte | Bandyopadhyay et al., 2012 | ||
| Antibody | SUN1 antibody (rabbit monoclonal) |
Abcam | ab124770 | IHC (1:1000) WB (1:100) |
| Antibody | SUN2 antibody (rabbit monoclonal) |
Abcam | ab124916 | IHC (1:1000) WB (1:100) |
| Antibody | Keratin 10 antibody (rabbit polyclonal) |
Gift from Julia Segre (Harmon et al., 2013) | IHC (1:500) | |
| Antibody | Keratin 1 antibody (chicken polyclonal) |
Gift from Julia Segre Harmon et al., 2013 | IHC (1:500) | |
| Antibody | Involucrin antibody (rabbit polyclonal) |
Gift from Julia Segre Harmon et al., 2013 | IHC (1:500) | |
| Antibody | Filaggrin antibody (chicken polyclonal) |
Gift from Julia Segre Harmon et al., 2013 | IHC (1:500) | |
| Antibody | β-Actin antibody (mouse monoclonal) |
Abcam | ab13772 | WB: 1:1000 |
| Antibody | Conformationally sensitive Lamin A/C antibody | Abcam | ab8984 | IF: 1:200 |
| Recombinant DNA reagent | N2G-JM-TSMod (plasmid) | This paper | Constructed from pEGFP-C1 containing mini-Nesprin-2G (Luxton et al., 2010) | |
| Recombinant DNA reagent | N2G-JM-TSMod Dark Venus (plasmid) | This paper | Mutation in Venus Y67L | |
| Recombinant DNA reagent | N2G-JM-TSMod Dark mTFP (plasmid) | This paper | Mutation in mTFP Y72L | |
| Recombinant DNA reagent | NoT_TSMod (Plasmid) | This paper | Constructed from pEGFP-C1 containing N2G-JM-TSMod | |
| Sequence-based reagent | Involucrin RNA FISH probe | Thermo Fisher | VB1-3030396-VC | |
| Sequence-based reagent | Sprr1b RNA FISH probe | Thermo Fisher | VB4-3117172-VC | |
| Sequence-based reagent | GAPDH_F | This paper | qPCR primer | AGGTCGGTGTGAACGGATTTG |
| Sequence-based reagent | GAPDH_R | This paper | qPCR primer | TGTAGACCATGTAGTTGAGGTCA |
| Sequence-based reagent | Sprr1b_F | This paper | qPCR primer | GATCCCAGCGACCACAC |
| Sequence-based reagent | Sprr1b_R | This paper | qPCR primer | GCTGATGTGAACTCATGCTTC |
| Sequence-based reagent | Sprr2d_F | This paper | qPCR primer | GTGGGCACACAGGTGGAG |
| Sequence-based reagent | Sprr2d_R | This paper | qPCR primer | GCCGAGACTACTTTGGAGAAC |
| Sequence-based reagent | Involucrin_F | This paper | qPCR primer | GCAGGAGAAGTAGATAGAG |
| Sequence-based reagent | Involucrin_R | This paper | qPCR primer | TTAAGGAAGTGTGGATGG |
| Sequence-based reagent | S100a14_F | This paper | qPCR primer | GGCAGGCTATAGGACA |
| Sequence-based reagent | S100a14_R | This paper | qPCR primer | CCTCAGCTCCGAGTAA |
| Peptide, recombinant protein | Fibronectin | Sigma-Aldrich | F4759 | 50 μg/mL |
| Peptide, recombinant protein | Poly-L-lysine | Sigma-Aldrich | P9155 | 50 μg/mL |
| Peptide, recombinant protein | Laminin | Thermo Fisher | CB-40232 | 50 μg/mL |
| Chemical compound, drug | Latrunculin A | Cayman Chemical Company | 10010630 | 0.5 μM |
| Commercial assay, kit | ViewRNA ISH Cell Assay kit | Thermo Fisher | QVC0001 | |
| Commercial assay, kit | Click-iTEdU Cell Proliferation Kit for Imaging | Invitrogen | C10337 | Alexa Fluor 488 dye |
| Commercial assay, kit | RNeasy Plus mini kit | QIAGEN | 74134 | |
| Commercial assay, kit | TruSeq RNA sample preparation kit | Illumina | RS-122-2001 | |
| Commercial assay, kit | iScript cDNA synthesis kit | Bio-Rad | 1708890 | |
| Commercial assay, kit | SYBR Green Supermix | Bio-Rad | 170-8882 | |
| Commercial assay, kit | Nextera Library Prep Kit | Illumina | 15028212 | |
| Commercial assay, kit | MinElute PCR Purification Kit | QIAGEN | 28004 | |
| Software, algorithm | ImageJ /Fiji | National Institutes of Health | Version 1.50e | |
| Software, algorithm | GraphPad Prism 8.0 | GraphPad | Version 8.0 | |
| Software, algorithm | PixFRET ImageJ Plugin | Feige et al., 2005 | ||
| Software, algorithm | Gaussian fit | This paper | https://github.com/LusKingLab/GaussianFit; Carley, 2021; copy archived at swh:1:rev:09e7545145b4dbbcb67d284a004d780176620130 | |
| Software, algorithm | BowTie/TopHat2 | Kim et al., 2013 | ||
| Software, algorithm | DESeq2 | Love et al., 2014 | ||
| Software, algorithm | ENCODE ATAC-seq pipeline | The ENCODE Project Consortium, 2013 Kundaje Lab | Version 1.8.0 | https://github.com/ENCODE-DCC/atac-seq-pipeline |
| Other | Prolong Gold with DAPI | Invitrogen | P36935 | |
| Other | Sera-Mag Select Beads | GE | 29343052 | |
| Other | CY 52–276 | Dow Corning | 52-276 | To make 3 kPa hydrogels |
| Other | Gil 2 Haematoxylin | Richard Allan Scientific | Cat # 72504 | |
| Other | Eosin-Y Alcoholic | Richard Allan Scientific | Cat # 71204 | |
| Other | JetPrime | Polyplus transfection | 114-07 | Transfection reagent |